ID: 1122409436

View in Genome Browser
Species Human (GRCh38)
Location 14:101518420-101518442
Sequence CTAACTGGCCCGTGGCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122409424_1122409436 8 Left 1122409424 14:101518389-101518411 CCTTCCCCAACTCTGTGTGTCCC No data
Right 1122409436 14:101518420-101518442 CTAACTGGCCCGTGGCCTCTGGG No data
1122409421_1122409436 28 Left 1122409421 14:101518369-101518391 CCCTATGATGGAGAGGAGACCCT No data
Right 1122409436 14:101518420-101518442 CTAACTGGCCCGTGGCCTCTGGG No data
1122409423_1122409436 9 Left 1122409423 14:101518388-101518410 CCCTTCCCCAACTCTGTGTGTCC No data
Right 1122409436 14:101518420-101518442 CTAACTGGCCCGTGGCCTCTGGG No data
1122409428_1122409436 2 Left 1122409428 14:101518395-101518417 CCAACTCTGTGTGTCCCAGGCCC No data
Right 1122409436 14:101518420-101518442 CTAACTGGCCCGTGGCCTCTGGG No data
1122409422_1122409436 27 Left 1122409422 14:101518370-101518392 CCTATGATGGAGAGGAGACCCTT No data
Right 1122409436 14:101518420-101518442 CTAACTGGCCCGTGGCCTCTGGG No data
1122409426_1122409436 4 Left 1122409426 14:101518393-101518415 CCCCAACTCTGTGTGTCCCAGGC No data
Right 1122409436 14:101518420-101518442 CTAACTGGCCCGTGGCCTCTGGG No data
1122409427_1122409436 3 Left 1122409427 14:101518394-101518416 CCCAACTCTGTGTGTCCCAGGCC No data
Right 1122409436 14:101518420-101518442 CTAACTGGCCCGTGGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122409436 Original CRISPR CTAACTGGCCCGTGGCCTCT GGG Intergenic
No off target data available for this crispr