ID: 1122409437

View in Genome Browser
Species Human (GRCh38)
Location 14:101518426-101518448
Sequence GGCCCGTGGCCTCTGGGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122409430_1122409437 -6 Left 1122409430 14:101518409-101518431 CCCAGGCCCATCTAACTGGCCCG No data
Right 1122409437 14:101518426-101518448 GGCCCGTGGCCTCTGGGTGACGG No data
1122409424_1122409437 14 Left 1122409424 14:101518389-101518411 CCTTCCCCAACTCTGTGTGTCCC No data
Right 1122409437 14:101518426-101518448 GGCCCGTGGCCTCTGGGTGACGG No data
1122409427_1122409437 9 Left 1122409427 14:101518394-101518416 CCCAACTCTGTGTGTCCCAGGCC No data
Right 1122409437 14:101518426-101518448 GGCCCGTGGCCTCTGGGTGACGG No data
1122409423_1122409437 15 Left 1122409423 14:101518388-101518410 CCCTTCCCCAACTCTGTGTGTCC No data
Right 1122409437 14:101518426-101518448 GGCCCGTGGCCTCTGGGTGACGG No data
1122409428_1122409437 8 Left 1122409428 14:101518395-101518417 CCAACTCTGTGTGTCCCAGGCCC No data
Right 1122409437 14:101518426-101518448 GGCCCGTGGCCTCTGGGTGACGG No data
1122409426_1122409437 10 Left 1122409426 14:101518393-101518415 CCCCAACTCTGTGTGTCCCAGGC No data
Right 1122409437 14:101518426-101518448 GGCCCGTGGCCTCTGGGTGACGG No data
1122409431_1122409437 -7 Left 1122409431 14:101518410-101518432 CCAGGCCCATCTAACTGGCCCGT No data
Right 1122409437 14:101518426-101518448 GGCCCGTGGCCTCTGGGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122409437 Original CRISPR GGCCCGTGGCCTCTGGGTGA CGG Intergenic
No off target data available for this crispr