ID: 1122409439

View in Genome Browser
Species Human (GRCh38)
Location 14:101518429-101518451
Sequence CTTCCGTCACCCAGAGGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122409439_1122409448 26 Left 1122409439 14:101518429-101518451 CCGTGGCCTCTGGGTGACGGAAG No data
Right 1122409448 14:101518478-101518500 TGCAATGGAAGCAAGTTCCCAGG No data
1122409439_1122409445 -8 Left 1122409439 14:101518429-101518451 CCGTGGCCTCTGGGTGACGGAAG No data
Right 1122409445 14:101518444-101518466 GACGGAAGGCCAGTGGGGACAGG No data
1122409439_1122409447 11 Left 1122409439 14:101518429-101518451 CCGTGGCCTCTGGGTGACGGAAG No data
Right 1122409447 14:101518463-101518485 CAGGCGCAAGCACAGTGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122409439 Original CRISPR CTTCCGTCACCCAGAGGCCA CGG (reversed) Intergenic
No off target data available for this crispr