ID: 1122409443

View in Genome Browser
Species Human (GRCh38)
Location 14:101518438-101518460
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122409431_1122409443 5 Left 1122409431 14:101518410-101518432 CCAGGCCCATCTAACTGGCCCGT No data
Right 1122409443 14:101518438-101518460 CTGGGTGACGGAAGGCCAGTGGG No data
1122409426_1122409443 22 Left 1122409426 14:101518393-101518415 CCCCAACTCTGTGTGTCCCAGGC No data
Right 1122409443 14:101518438-101518460 CTGGGTGACGGAAGGCCAGTGGG No data
1122409428_1122409443 20 Left 1122409428 14:101518395-101518417 CCAACTCTGTGTGTCCCAGGCCC No data
Right 1122409443 14:101518438-101518460 CTGGGTGACGGAAGGCCAGTGGG No data
1122409427_1122409443 21 Left 1122409427 14:101518394-101518416 CCCAACTCTGTGTGTCCCAGGCC No data
Right 1122409443 14:101518438-101518460 CTGGGTGACGGAAGGCCAGTGGG No data
1122409430_1122409443 6 Left 1122409430 14:101518409-101518431 CCCAGGCCCATCTAACTGGCCCG No data
Right 1122409443 14:101518438-101518460 CTGGGTGACGGAAGGCCAGTGGG No data
1122409433_1122409443 0 Left 1122409433 14:101518415-101518437 CCCATCTAACTGGCCCGTGGCCT No data
Right 1122409443 14:101518438-101518460 CTGGGTGACGGAAGGCCAGTGGG No data
1122409424_1122409443 26 Left 1122409424 14:101518389-101518411 CCTTCCCCAACTCTGTGTGTCCC No data
Right 1122409443 14:101518438-101518460 CTGGGTGACGGAAGGCCAGTGGG No data
1122409434_1122409443 -1 Left 1122409434 14:101518416-101518438 CCATCTAACTGGCCCGTGGCCTC No data
Right 1122409443 14:101518438-101518460 CTGGGTGACGGAAGGCCAGTGGG No data
1122409423_1122409443 27 Left 1122409423 14:101518388-101518410 CCCTTCCCCAACTCTGTGTGTCC No data
Right 1122409443 14:101518438-101518460 CTGGGTGACGGAAGGCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122409443 Original CRISPR CTGGGTGACGGAAGGCCAGT GGG Intergenic
No off target data available for this crispr