ID: 1122410493

View in Genome Browser
Species Human (GRCh38)
Location 14:101523231-101523253
Sequence GCCCTGTGGAAGCACCGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122410493_1122410495 -8 Left 1122410493 14:101523231-101523253 CCTTGACGGTGCTTCCACAGGGC No data
Right 1122410495 14:101523246-101523268 CACAGGGCCCACCTGTGTACTGG No data
1122410493_1122410499 8 Left 1122410493 14:101523231-101523253 CCTTGACGGTGCTTCCACAGGGC No data
Right 1122410499 14:101523262-101523284 GTACTGGATTCTGCTTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122410493 Original CRISPR GCCCTGTGGAAGCACCGTCA AGG (reversed) Intergenic
No off target data available for this crispr