ID: 1122411020

View in Genome Browser
Species Human (GRCh38)
Location 14:101526259-101526281
Sequence GTGAGCATTCCTGGTACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122411010_1122411020 20 Left 1122411010 14:101526216-101526238 CCTCTCCCTGACCGCAGCAAGTC No data
Right 1122411020 14:101526259-101526281 GTGAGCATTCCTGGTACTGCTGG No data
1122411011_1122411020 15 Left 1122411011 14:101526221-101526243 CCCTGACCGCAGCAAGTCTTCCT No data
Right 1122411020 14:101526259-101526281 GTGAGCATTCCTGGTACTGCTGG No data
1122411017_1122411020 -5 Left 1122411017 14:101526241-101526263 CCTCACTCCACAGGGGTCGTGAG No data
Right 1122411020 14:101526259-101526281 GTGAGCATTCCTGGTACTGCTGG No data
1122411012_1122411020 14 Left 1122411012 14:101526222-101526244 CCTGACCGCAGCAAGTCTTCCTC No data
Right 1122411020 14:101526259-101526281 GTGAGCATTCCTGGTACTGCTGG No data
1122411009_1122411020 30 Left 1122411009 14:101526206-101526228 CCTAGGAGCTCCTCTCCCTGACC No data
Right 1122411020 14:101526259-101526281 GTGAGCATTCCTGGTACTGCTGG No data
1122411013_1122411020 9 Left 1122411013 14:101526227-101526249 CCGCAGCAAGTCTTCCTCACTCC No data
Right 1122411020 14:101526259-101526281 GTGAGCATTCCTGGTACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122411020 Original CRISPR GTGAGCATTCCTGGTACTGC TGG Intergenic
No off target data available for this crispr