ID: 1122414340

View in Genome Browser
Species Human (GRCh38)
Location 14:101541703-101541725
Sequence AAGGTCTGCCTCTGCCACTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122414340_1122414347 26 Left 1122414340 14:101541703-101541725 CCGCAGTGGCAGAGGCAGACCTT No data
Right 1122414347 14:101541752-101541774 TCCTCTGCTCCATGATGGAGTGG No data
1122414340_1122414343 -8 Left 1122414340 14:101541703-101541725 CCGCAGTGGCAGAGGCAGACCTT No data
Right 1122414343 14:101541718-101541740 CAGACCTTGGTGAGCCTGGCAGG No data
1122414340_1122414346 21 Left 1122414340 14:101541703-101541725 CCGCAGTGGCAGAGGCAGACCTT No data
Right 1122414346 14:101541747-101541769 TCAACTCCTCTGCTCCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122414340 Original CRISPR AAGGTCTGCCTCTGCCACTG CGG (reversed) Intergenic
No off target data available for this crispr