ID: 1122414344

View in Genome Browser
Species Human (GRCh38)
Location 14:101541722-101541744
Sequence GATGCCTGCCAGGCTCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122414344_1122414349 13 Left 1122414344 14:101541722-101541744 CCTTGGTGAGCCTGGCAGGCATC No data
Right 1122414349 14:101541758-101541780 GCTCCATGATGGAGTGGTTCTGG No data
1122414344_1122414350 14 Left 1122414344 14:101541722-101541744 CCTTGGTGAGCCTGGCAGGCATC No data
Right 1122414350 14:101541759-101541781 CTCCATGATGGAGTGGTTCTGGG No data
1122414344_1122414346 2 Left 1122414344 14:101541722-101541744 CCTTGGTGAGCCTGGCAGGCATC No data
Right 1122414346 14:101541747-101541769 TCAACTCCTCTGCTCCATGATGG No data
1122414344_1122414347 7 Left 1122414344 14:101541722-101541744 CCTTGGTGAGCCTGGCAGGCATC No data
Right 1122414347 14:101541752-101541774 TCCTCTGCTCCATGATGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122414344 Original CRISPR GATGCCTGCCAGGCTCACCA AGG (reversed) Intergenic