ID: 1122414345

View in Genome Browser
Species Human (GRCh38)
Location 14:101541732-101541754
Sequence GGAGTTGAAAGATGCCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122414345_1122414349 3 Left 1122414345 14:101541732-101541754 CCTGGCAGGCATCTTTCAACTCC No data
Right 1122414349 14:101541758-101541780 GCTCCATGATGGAGTGGTTCTGG No data
1122414345_1122414353 30 Left 1122414345 14:101541732-101541754 CCTGGCAGGCATCTTTCAACTCC No data
Right 1122414353 14:101541785-101541807 CAGCCAGCAGTACCTGTAGGTGG No data
1122414345_1122414347 -3 Left 1122414345 14:101541732-101541754 CCTGGCAGGCATCTTTCAACTCC No data
Right 1122414347 14:101541752-101541774 TCCTCTGCTCCATGATGGAGTGG No data
1122414345_1122414352 27 Left 1122414345 14:101541732-101541754 CCTGGCAGGCATCTTTCAACTCC No data
Right 1122414352 14:101541782-101541804 TCTCAGCCAGCAGTACCTGTAGG No data
1122414345_1122414350 4 Left 1122414345 14:101541732-101541754 CCTGGCAGGCATCTTTCAACTCC No data
Right 1122414350 14:101541759-101541781 CTCCATGATGGAGTGGTTCTGGG No data
1122414345_1122414346 -8 Left 1122414345 14:101541732-101541754 CCTGGCAGGCATCTTTCAACTCC No data
Right 1122414346 14:101541747-101541769 TCAACTCCTCTGCTCCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122414345 Original CRISPR GGAGTTGAAAGATGCCTGCC AGG (reversed) Intergenic