ID: 1122414347

View in Genome Browser
Species Human (GRCh38)
Location 14:101541752-101541774
Sequence TCCTCTGCTCCATGATGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122414340_1122414347 26 Left 1122414340 14:101541703-101541725 CCGCAGTGGCAGAGGCAGACCTT No data
Right 1122414347 14:101541752-101541774 TCCTCTGCTCCATGATGGAGTGG No data
1122414345_1122414347 -3 Left 1122414345 14:101541732-101541754 CCTGGCAGGCATCTTTCAACTCC No data
Right 1122414347 14:101541752-101541774 TCCTCTGCTCCATGATGGAGTGG No data
1122414344_1122414347 7 Left 1122414344 14:101541722-101541744 CCTTGGTGAGCCTGGCAGGCATC No data
Right 1122414347 14:101541752-101541774 TCCTCTGCTCCATGATGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122414347 Original CRISPR TCCTCTGCTCCATGATGGAG TGG Intergenic
No off target data available for this crispr