ID: 1122414348

View in Genome Browser
Species Human (GRCh38)
Location 14:101541753-101541775
Sequence ACCACTCCATCATGGAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122414348_1122414353 9 Left 1122414348 14:101541753-101541775 CCTCTGCTCCATGATGGAGTGGT No data
Right 1122414353 14:101541785-101541807 CAGCCAGCAGTACCTGTAGGTGG No data
1122414348_1122414356 23 Left 1122414348 14:101541753-101541775 CCTCTGCTCCATGATGGAGTGGT No data
Right 1122414356 14:101541799-101541821 TGTAGGTGGCCCCTGACTCCTGG No data
1122414348_1122414352 6 Left 1122414348 14:101541753-101541775 CCTCTGCTCCATGATGGAGTGGT No data
Right 1122414352 14:101541782-101541804 TCTCAGCCAGCAGTACCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122414348 Original CRISPR ACCACTCCATCATGGAGCAG AGG (reversed) Intergenic
No off target data available for this crispr