ID: 1122414350

View in Genome Browser
Species Human (GRCh38)
Location 14:101541759-101541781
Sequence CTCCATGATGGAGTGGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122414345_1122414350 4 Left 1122414345 14:101541732-101541754 CCTGGCAGGCATCTTTCAACTCC No data
Right 1122414350 14:101541759-101541781 CTCCATGATGGAGTGGTTCTGGG No data
1122414344_1122414350 14 Left 1122414344 14:101541722-101541744 CCTTGGTGAGCCTGGCAGGCATC No data
Right 1122414350 14:101541759-101541781 CTCCATGATGGAGTGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122414350 Original CRISPR CTCCATGATGGAGTGGTTCT GGG Intergenic
No off target data available for this crispr