ID: 1122414351

View in Genome Browser
Species Human (GRCh38)
Location 14:101541761-101541783
Sequence GACCCAGAACCACTCCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122414351_1122414353 1 Left 1122414351 14:101541761-101541783 CCATGATGGAGTGGTTCTGGGTC No data
Right 1122414353 14:101541785-101541807 CAGCCAGCAGTACCTGTAGGTGG No data
1122414351_1122414356 15 Left 1122414351 14:101541761-101541783 CCATGATGGAGTGGTTCTGGGTC No data
Right 1122414356 14:101541799-101541821 TGTAGGTGGCCCCTGACTCCTGG No data
1122414351_1122414352 -2 Left 1122414351 14:101541761-101541783 CCATGATGGAGTGGTTCTGGGTC No data
Right 1122414352 14:101541782-101541804 TCTCAGCCAGCAGTACCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122414351 Original CRISPR GACCCAGAACCACTCCATCA TGG (reversed) Intergenic
No off target data available for this crispr