ID: 1122414353

View in Genome Browser
Species Human (GRCh38)
Location 14:101541785-101541807
Sequence CAGCCAGCAGTACCTGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122414348_1122414353 9 Left 1122414348 14:101541753-101541775 CCTCTGCTCCATGATGGAGTGGT No data
Right 1122414353 14:101541785-101541807 CAGCCAGCAGTACCTGTAGGTGG No data
1122414345_1122414353 30 Left 1122414345 14:101541732-101541754 CCTGGCAGGCATCTTTCAACTCC No data
Right 1122414353 14:101541785-101541807 CAGCCAGCAGTACCTGTAGGTGG No data
1122414351_1122414353 1 Left 1122414351 14:101541761-101541783 CCATGATGGAGTGGTTCTGGGTC No data
Right 1122414353 14:101541785-101541807 CAGCCAGCAGTACCTGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122414353 Original CRISPR CAGCCAGCAGTACCTGTAGG TGG Intergenic
No off target data available for this crispr