ID: 1122415440

View in Genome Browser
Species Human (GRCh38)
Location 14:101547444-101547466
Sequence CGTGAGGTGCTCACATTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122415440_1122415445 -4 Left 1122415440 14:101547444-101547466 CCAGCCAATGTGAGCACCTCACG No data
Right 1122415445 14:101547463-101547485 CACGGAGCACAGGCTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122415440 Original CRISPR CGTGAGGTGCTCACATTGGC TGG (reversed) Intergenic
No off target data available for this crispr