ID: 1122415445

View in Genome Browser
Species Human (GRCh38)
Location 14:101547463-101547485
Sequence CACGGAGCACAGGCTGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122415433_1122415445 20 Left 1122415433 14:101547420-101547442 CCGCTGCCTCGAGATACCCCTAC No data
Right 1122415445 14:101547463-101547485 CACGGAGCACAGGCTGCACCTGG No data
1122415435_1122415445 4 Left 1122415435 14:101547436-101547458 CCCCTACCCCAGCCAATGTGAGC No data
Right 1122415445 14:101547463-101547485 CACGGAGCACAGGCTGCACCTGG No data
1122415440_1122415445 -4 Left 1122415440 14:101547444-101547466 CCAGCCAATGTGAGCACCTCACG No data
Right 1122415445 14:101547463-101547485 CACGGAGCACAGGCTGCACCTGG No data
1122415430_1122415445 25 Left 1122415430 14:101547415-101547437 CCCCACCGCTGCCTCGAGATACC No data
Right 1122415445 14:101547463-101547485 CACGGAGCACAGGCTGCACCTGG No data
1122415434_1122415445 14 Left 1122415434 14:101547426-101547448 CCTCGAGATACCCCTACCCCAGC No data
Right 1122415445 14:101547463-101547485 CACGGAGCACAGGCTGCACCTGG No data
1122415432_1122415445 23 Left 1122415432 14:101547417-101547439 CCACCGCTGCCTCGAGATACCCC No data
Right 1122415445 14:101547463-101547485 CACGGAGCACAGGCTGCACCTGG No data
1122415437_1122415445 2 Left 1122415437 14:101547438-101547460 CCTACCCCAGCCAATGTGAGCAC No data
Right 1122415445 14:101547463-101547485 CACGGAGCACAGGCTGCACCTGG No data
1122415442_1122415445 -8 Left 1122415442 14:101547448-101547470 CCAATGTGAGCACCTCACGGAGC No data
Right 1122415445 14:101547463-101547485 CACGGAGCACAGGCTGCACCTGG No data
1122415431_1122415445 24 Left 1122415431 14:101547416-101547438 CCCACCGCTGCCTCGAGATACCC No data
Right 1122415445 14:101547463-101547485 CACGGAGCACAGGCTGCACCTGG No data
1122415439_1122415445 -3 Left 1122415439 14:101547443-101547465 CCCAGCCAATGTGAGCACCTCAC No data
Right 1122415445 14:101547463-101547485 CACGGAGCACAGGCTGCACCTGG No data
1122415436_1122415445 3 Left 1122415436 14:101547437-101547459 CCCTACCCCAGCCAATGTGAGCA No data
Right 1122415445 14:101547463-101547485 CACGGAGCACAGGCTGCACCTGG No data
1122415438_1122415445 -2 Left 1122415438 14:101547442-101547464 CCCCAGCCAATGTGAGCACCTCA No data
Right 1122415445 14:101547463-101547485 CACGGAGCACAGGCTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122415445 Original CRISPR CACGGAGCACAGGCTGCACC TGG Intergenic
No off target data available for this crispr