ID: 1122415995

View in Genome Browser
Species Human (GRCh38)
Location 14:101549761-101549783
Sequence GGTGTCCTCGGTGGCTGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122415995_1122416005 -5 Left 1122415995 14:101549761-101549783 CCGGCCCAGCCACCGAGGACACC No data
Right 1122416005 14:101549779-101549801 ACACCAGGGGACCCAGGGCCAGG No data
1122415995_1122416010 8 Left 1122415995 14:101549761-101549783 CCGGCCCAGCCACCGAGGACACC No data
Right 1122416010 14:101549792-101549814 CAGGGCCAGGATGTCCATGGTGG No data
1122415995_1122416013 16 Left 1122415995 14:101549761-101549783 CCGGCCCAGCCACCGAGGACACC No data
Right 1122416013 14:101549800-101549822 GGATGTCCATGGTGGCCTCAGGG No data
1122415995_1122416015 30 Left 1122415995 14:101549761-101549783 CCGGCCCAGCCACCGAGGACACC No data
Right 1122416015 14:101549814-101549836 GCCTCAGGGAGCCCCACTGCAGG No data
1122415995_1122416012 15 Left 1122415995 14:101549761-101549783 CCGGCCCAGCCACCGAGGACACC No data
Right 1122416012 14:101549799-101549821 AGGATGTCCATGGTGGCCTCAGG No data
1122415995_1122416007 5 Left 1122415995 14:101549761-101549783 CCGGCCCAGCCACCGAGGACACC No data
Right 1122416007 14:101549789-101549811 ACCCAGGGCCAGGATGTCCATGG No data
1122415995_1122416004 -10 Left 1122415995 14:101549761-101549783 CCGGCCCAGCCACCGAGGACACC No data
Right 1122416004 14:101549774-101549796 CGAGGACACCAGGGGACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122415995 Original CRISPR GGTGTCCTCGGTGGCTGGGC CGG (reversed) Intergenic