ID: 1122418571

View in Genome Browser
Species Human (GRCh38)
Location 14:101561643-101561665
Sequence AGGCCGTGCCGAGGAAGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122418571_1122418577 26 Left 1122418571 14:101561643-101561665 CCCGCGCTTCCTCGGCACGGCCT 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1122418577 14:101561692-101561714 TGTATCCGCAAGCATTTCCTGGG 0: 1
1: 0
2: 0
3: 1
4: 66
1122418571_1122418576 25 Left 1122418571 14:101561643-101561665 CCCGCGCTTCCTCGGCACGGCCT 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1122418576 14:101561691-101561713 GTGTATCCGCAAGCATTTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122418571 Original CRISPR AGGCCGTGCCGAGGAAGCGC GGG (reversed) Exonic