ID: 1122421040

View in Genome Browser
Species Human (GRCh38)
Location 14:101577547-101577569
Sequence CTGGAAGGGCCACAGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122421029_1122421040 10 Left 1122421029 14:101577514-101577536 CCCAGAGCCCTGATGGATGGGCC No data
Right 1122421040 14:101577547-101577569 CTGGAAGGGCCACAGGGACAGGG No data
1122421030_1122421040 9 Left 1122421030 14:101577515-101577537 CCAGAGCCCTGATGGATGGGCCA No data
Right 1122421040 14:101577547-101577569 CTGGAAGGGCCACAGGGACAGGG No data
1122421032_1122421040 2 Left 1122421032 14:101577522-101577544 CCTGATGGATGGGCCAGCTACTC No data
Right 1122421040 14:101577547-101577569 CTGGAAGGGCCACAGGGACAGGG No data
1122421031_1122421040 3 Left 1122421031 14:101577521-101577543 CCCTGATGGATGGGCCAGCTACT No data
Right 1122421040 14:101577547-101577569 CTGGAAGGGCCACAGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122421040 Original CRISPR CTGGAAGGGCCACAGGGACA GGG Intergenic
No off target data available for this crispr