ID: 1122423370

View in Genome Browser
Species Human (GRCh38)
Location 14:101591096-101591118
Sequence CTGGCAAAACAGACCTACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122423370_1122423374 -10 Left 1122423370 14:101591096-101591118 CCCAGGTAGGTCTGTTTTGCCAG No data
Right 1122423374 14:101591109-101591131 GTTTTGCCAGACCTGGGAACAGG No data
1122423370_1122423378 5 Left 1122423370 14:101591096-101591118 CCCAGGTAGGTCTGTTTTGCCAG No data
Right 1122423378 14:101591124-101591146 GGAACAGGGACCCTGACATATGG No data
1122423370_1122423375 -9 Left 1122423370 14:101591096-101591118 CCCAGGTAGGTCTGTTTTGCCAG No data
Right 1122423375 14:101591110-101591132 TTTTGCCAGACCTGGGAACAGGG No data
1122423370_1122423380 13 Left 1122423370 14:101591096-101591118 CCCAGGTAGGTCTGTTTTGCCAG No data
Right 1122423380 14:101591132-101591154 GACCCTGACATATGGGCCAGAGG No data
1122423370_1122423379 6 Left 1122423370 14:101591096-101591118 CCCAGGTAGGTCTGTTTTGCCAG No data
Right 1122423379 14:101591125-101591147 GAACAGGGACCCTGACATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122423370 Original CRISPR CTGGCAAAACAGACCTACCT GGG (reversed) Intergenic
No off target data available for this crispr