ID: 1122425190

View in Genome Browser
Species Human (GRCh38)
Location 14:101601679-101601701
Sequence CAGAAGGCTCAGAGAGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122425190_1122425194 -8 Left 1122425190 14:101601679-101601701 CCCTCACCTCTCTGAGCCTTCTG No data
Right 1122425194 14:101601694-101601716 GCCTTCTGGCCCATAAAATGAGG No data
1122425190_1122425206 29 Left 1122425190 14:101601679-101601701 CCCTCACCTCTCTGAGCCTTCTG No data
Right 1122425206 14:101601731-101601753 CCCCGCTGTTGGAAAGTGAGTGG No data
1122425190_1122425199 18 Left 1122425190 14:101601679-101601701 CCCTCACCTCTCTGAGCCTTCTG No data
Right 1122425199 14:101601720-101601742 AATGCCCCCTCCCCCGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122425190 Original CRISPR CAGAAGGCTCAGAGAGGTGA GGG (reversed) Intergenic
No off target data available for this crispr