ID: 1122425999

View in Genome Browser
Species Human (GRCh38)
Location 14:101605599-101605621
Sequence GCACCTGCTGCTGTCTCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122425996_1122425999 11 Left 1122425996 14:101605565-101605587 CCCTATTGCATCATATCCTGGCT No data
Right 1122425999 14:101605599-101605621 GCACCTGCTGCTGTCTCTCATGG No data
1122425997_1122425999 10 Left 1122425997 14:101605566-101605588 CCTATTGCATCATATCCTGGCTT No data
Right 1122425999 14:101605599-101605621 GCACCTGCTGCTGTCTCTCATGG No data
1122425993_1122425999 23 Left 1122425993 14:101605553-101605575 CCATCCATGGCTCCCTATTGCAT No data
Right 1122425999 14:101605599-101605621 GCACCTGCTGCTGTCTCTCATGG No data
1122425998_1122425999 -5 Left 1122425998 14:101605581-101605603 CCTGGCTTTCTGACTGTAGCACC No data
Right 1122425999 14:101605599-101605621 GCACCTGCTGCTGTCTCTCATGG No data
1122425994_1122425999 19 Left 1122425994 14:101605557-101605579 CCATGGCTCCCTATTGCATCATA No data
Right 1122425999 14:101605599-101605621 GCACCTGCTGCTGTCTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122425999 Original CRISPR GCACCTGCTGCTGTCTCTCA TGG Intergenic