ID: 1122432655

View in Genome Browser
Species Human (GRCh38)
Location 14:101665544-101665566
Sequence GACTAGTGGTCTTGGTGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122432639_1122432655 26 Left 1122432639 14:101665495-101665517 CCAGGACCCACCAAAGGTAGGCT No data
Right 1122432655 14:101665544-101665566 GACTAGTGGTCTTGGTGTAAGGG No data
1122432642_1122432655 20 Left 1122432642 14:101665501-101665523 CCCACCAAAGGTAGGCTCTGGGA No data
Right 1122432655 14:101665544-101665566 GACTAGTGGTCTTGGTGTAAGGG No data
1122432643_1122432655 19 Left 1122432643 14:101665502-101665524 CCACCAAAGGTAGGCTCTGGGAC No data
Right 1122432655 14:101665544-101665566 GACTAGTGGTCTTGGTGTAAGGG No data
1122432651_1122432655 -3 Left 1122432651 14:101665524-101665546 CCTCTCTTGCTTGGGGTGGGGAC No data
Right 1122432655 14:101665544-101665566 GACTAGTGGTCTTGGTGTAAGGG No data
1122432644_1122432655 16 Left 1122432644 14:101665505-101665527 CCAAAGGTAGGCTCTGGGACCTC No data
Right 1122432655 14:101665544-101665566 GACTAGTGGTCTTGGTGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122432655 Original CRISPR GACTAGTGGTCTTGGTGTAA GGG Intergenic
No off target data available for this crispr