ID: 1122440776

View in Genome Browser
Species Human (GRCh38)
Location 14:101730472-101730494
Sequence GACTCACAGTTCCACGGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14895
Summary {0: 1, 1: 21, 2: 901, 3: 5473, 4: 8499}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122440776_1122440783 25 Left 1122440776 14:101730472-101730494 CCAGGCCCGTGGAACTGTGAGTC 0: 1
1: 21
2: 901
3: 5473
4: 8499
Right 1122440783 14:101730520-101730542 CCTTATAATTTACCCAGTCTCGG 0: 2
1: 151
2: 3861
3: 4611
4: 3372
1122440776_1122440784 26 Left 1122440776 14:101730472-101730494 CCAGGCCCGTGGAACTGTGAGTC 0: 1
1: 21
2: 901
3: 5473
4: 8499
Right 1122440784 14:101730521-101730543 CTTATAATTTACCCAGTCTCGGG 0: 7
1: 517
2: 7831
3: 14330
4: 14695

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122440776 Original CRISPR GACTCACAGTTCCACGGGCC TGG (reversed) Exonic
Too many off-targets to display for this crispr