ID: 1122441997

View in Genome Browser
Species Human (GRCh38)
Location 14:101738187-101738209
Sequence CCGTGTGGCTGTCTCGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122441997_1122442003 6 Left 1122441997 14:101738187-101738209 CCTGAAACGAGACAGCCACACGG No data
Right 1122442003 14:101738216-101738238 TGTGTAAAGGGCAAGTGCCACGG No data
1122441997_1122442001 -7 Left 1122441997 14:101738187-101738209 CCTGAAACGAGACAGCCACACGG No data
Right 1122442001 14:101738203-101738225 CACACGGTGGTGCTGTGTAAAGG No data
1122441997_1122442002 -6 Left 1122441997 14:101738187-101738209 CCTGAAACGAGACAGCCACACGG No data
Right 1122442002 14:101738204-101738226 ACACGGTGGTGCTGTGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122441997 Original CRISPR CCGTGTGGCTGTCTCGTTTC AGG (reversed) Intergenic
No off target data available for this crispr