ID: 1122442564

View in Genome Browser
Species Human (GRCh38)
Location 14:101742289-101742311
Sequence CTTTGGGAGGGCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270098
Summary {0: 7, 1: 1361, 2: 26677, 3: 81625, 4: 160428}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122442564_1122442570 -8 Left 1122442564 14:101742289-101742311 CCATCCACCTTGCCCTCCCAAAG 0: 7
1: 1361
2: 26677
3: 81625
4: 160428
Right 1122442570 14:101742304-101742326 TCCCAAAGTGCTAGGATTACAGG 0: 21761
1: 309030
2: 254826
3: 140031
4: 128248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122442564 Original CRISPR CTTTGGGAGGGCAAGGTGGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr