ID: 1122444643

View in Genome Browser
Species Human (GRCh38)
Location 14:101760631-101760653
Sequence CTTGCGGGAGAAACTGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122444631_1122444643 15 Left 1122444631 14:101760593-101760615 CCAACCAGGAAAGGACGGGACTG No data
Right 1122444643 14:101760631-101760653 CTTGCGGGAGAAACTGCGGAGGG No data
1122444632_1122444643 11 Left 1122444632 14:101760597-101760619 CCAGGAAAGGACGGGACTGTCGG No data
Right 1122444643 14:101760631-101760653 CTTGCGGGAGAAACTGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122444643 Original CRISPR CTTGCGGGAGAAACTGCGGA GGG Intergenic
No off target data available for this crispr