ID: 1122445141

View in Genome Browser
Species Human (GRCh38)
Location 14:101762151-101762173
Sequence GGCCGCTGGGACCTTCGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122445127_1122445141 14 Left 1122445127 14:101762114-101762136 CCCGGGGATCGCGCCGGAGCCGC 0: 1
1: 1
2: 1
3: 9
4: 81
Right 1122445141 14:101762151-101762173 GGCCGCTGGGACCTTCGTGATGG 0: 1
1: 0
2: 0
3: 3
4: 75
1122445133_1122445141 1 Left 1122445133 14:101762127-101762149 CCGGAGCCGCGGGGCGCAGGCCC 0: 1
1: 1
2: 1
3: 25
4: 242
Right 1122445141 14:101762151-101762173 GGCCGCTGGGACCTTCGTGATGG 0: 1
1: 0
2: 0
3: 3
4: 75
1122445136_1122445141 -5 Left 1122445136 14:101762133-101762155 CCGCGGGGCGCAGGCCCGGGCCG 0: 1
1: 0
2: 2
3: 35
4: 338
Right 1122445141 14:101762151-101762173 GGCCGCTGGGACCTTCGTGATGG 0: 1
1: 0
2: 0
3: 3
4: 75
1122445128_1122445141 13 Left 1122445128 14:101762115-101762137 CCGGGGATCGCGCCGGAGCCGCG 0: 1
1: 0
2: 2
3: 8
4: 98
Right 1122445141 14:101762151-101762173 GGCCGCTGGGACCTTCGTGATGG 0: 1
1: 0
2: 0
3: 3
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122445141 Original CRISPR GGCCGCTGGGACCTTCGTGA TGG Intronic
903668285 1:25021212-25021234 GGCCGCAGGGACCTCAGGGAGGG + Intergenic
904040236 1:27580095-27580117 GGCCCATGGGCCCTTCTTGATGG + Intronic
920199666 1:204251823-204251845 GGCCACTGGGACCTTGCTGGAGG + Intronic
920850129 1:209623044-209623066 GGCCGGTGGGGCCTTCTTGATGG - Exonic
1069566588 10:69467376-69467398 GGCCACTGAGACTTTCCTGATGG + Intronic
1072188084 10:93060967-93060989 GGCAGCAGGCACCTTCGAGAGGG + Intergenic
1075401154 10:122162743-122162765 GGGCACTGGGAGCTTGGTGATGG + Intronic
1075664459 10:124220768-124220790 GGCTGCTGGGACTTTGGTGGGGG - Intergenic
1078901991 11:15650447-15650469 GGACCCTGGCACCCTCGTGAGGG + Intergenic
1084123317 11:67082239-67082261 GGCCGGCGGGACCTTCCTGCTGG + Intergenic
1084713208 11:70857090-70857112 GGCTGCTGGGGCCATCGTCAGGG - Intronic
1092012570 12:5127059-5127081 TGCAGCTGGGCCCTTCCTGAAGG + Intergenic
1100179879 12:92073665-92073687 AGCCACTGGGACCTACTTGAGGG - Intronic
1110803413 13:79726935-79726957 GGACTCTGGGAACTTCATGATGG + Intergenic
1111397029 13:87677428-87677450 GGCCGCCGGGCTCTTCGTGCTGG + Exonic
1112033231 13:95475605-95475627 GGCCTCTGGGCCCCTGGTGAGGG + Intronic
1112227404 13:97553296-97553318 AGACGCTGGGACCTACTTGAGGG - Intergenic
1122445141 14:101762151-101762173 GGCCGCTGGGACCTTCGTGATGG + Intronic
1127433321 15:58933290-58933312 AGCCGCTGGGACCTGCGGAACGG - Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1130305509 15:82710072-82710094 GGACGCTGGGACCGTCTTGCAGG + Intergenic
1130328444 15:82900792-82900814 GGCAGCTGTGACCTCCTTGAAGG - Intronic
1131982918 15:98012994-98013016 AGACGCTGGGACCTACTTGAGGG + Intergenic
1132348320 15:101121767-101121789 GGCTGCTGGCGCCCTCGTGAGGG - Intergenic
1133223124 16:4327747-4327769 GGCCGCGGGGACCACCGGGACGG - Intronic
1138388429 16:56652353-56652375 TGGAGCTGGGACCTTCCTGATGG + Intronic
1140458117 16:75116260-75116282 GGCTTCTGGGCCCTTCGTGGGGG + Intronic
1142354554 16:89596439-89596461 TACCTCTGGGACCTTCGAGATGG - Intronic
1151584994 17:75003509-75003531 GGCCTCAGGGGCCTGCGTGAGGG - Exonic
1152244233 17:79176967-79176989 AGCAGCTGGGACCTCCGTGAAGG - Intronic
1155199206 18:23503111-23503133 AGCCTCTGGGAGCTTCGTCAGGG - Intergenic
1156406584 18:36788460-36788482 GGGCGCTGGGGCCTTGGTAAAGG + Intronic
1160173350 18:76572621-76572643 GGCCACCGGGAACTTCATGATGG + Intergenic
1161199241 19:3005471-3005493 CGCTGCTGGGACCTGCGGGAGGG - Exonic
1161209159 19:3057313-3057335 GGACGCTGGGACCTTGGCGGTGG + Intronic
1161563112 19:4984665-4984687 TGCCGCTGGGGCCCTCGGGAGGG + Intronic
1163622387 19:18368824-18368846 GGCCTCTGGGAGCTGCGTGACGG + Exonic
1165914079 19:39247419-39247441 GGCCCCGGGGACCTTCCTGGAGG + Intergenic
1165916795 19:39265513-39265535 GGCCCCGGGGACCTTCCTGGAGG - Intergenic
948788121 2:240363579-240363601 GTCCGCTGTGACCTTGGTCAAGG - Intergenic
948894076 2:240920172-240920194 GGCAGCCTGGCCCTTCGTGAGGG + Intronic
949030707 2:241795872-241795894 GGCCGCTGGGAGCCTCTTCAAGG + Intronic
1174461281 20:50684686-50684708 GGCCGCTGGGACCAGGGTGGAGG + Intronic
1180028646 21:45185247-45185269 TGCTGCTGGGACCCCCGTGAGGG + Intronic
1181838365 22:25629820-25629842 GGTGGCTGGGAGCTTAGTGAGGG + Intronic
1185373451 22:50471280-50471302 GGCCGCAGGGACATTGGTGCAGG - Intronic
970692222 4:18632852-18632874 GGACACTGGGACCTACTTGAGGG + Intergenic
972311494 4:37887847-37887869 GGCCAATGGGGCCTTGGTGATGG - Intergenic
975696923 4:77022849-77022871 GGCCACTGGGCCCTTCCTGGTGG - Intronic
983939587 4:173525713-173525735 GGCCGCTGGGACTTTCTTCTGGG + Intronic
983940493 4:173530675-173530697 GGGCGCCGGGAGCCTCGTGACGG + Intergenic
992074966 5:73183842-73183864 GAACGCTGGGACCGTGGTGAAGG + Intergenic
994558458 5:101334599-101334621 AGACACTGGGACCTTCTTGAGGG + Intergenic
999054068 5:148554808-148554830 AGACACTGGGACCTACGTGAGGG - Intronic
1001487827 5:172132463-172132485 GACCACTGGGACCTTCATCACGG - Intronic
1003990945 6:11486008-11486030 GGCCGCTGGGAAATTTATGAGGG - Intergenic
1006274683 6:32993761-32993783 AGACACTGGGACCTTTGTGAAGG + Intergenic
1011970842 6:93220724-93220746 GGCCTCAGGGGCCTTCCTGAGGG + Intergenic
1012144287 6:95662110-95662132 GGACACTGGGACCTTTTTGAGGG + Intergenic
1015124801 6:129742081-129742103 GGCAGCTGGGAACTTCAGGATGG - Intergenic
1015937015 6:138414547-138414569 GGCGGCTGGTACTTTCTTGAAGG - Exonic
1017783342 6:157733630-157733652 GGCAGCTAGGACCATGGTGAGGG + Intronic
1019143096 6:169960680-169960702 GGCCGCTGGGCCCTTCCTTCAGG + Intergenic
1019282944 7:209677-209699 GGCCGCTGGCCCCTTCCTGTGGG - Intronic
1021579501 7:22138158-22138180 TGCCACTGGGACATTTGTGAGGG - Intronic
1023939631 7:44761335-44761357 CCCCGCAGGGACCTTGGTGAAGG - Intronic
1024848323 7:53677619-53677641 AGACACTGGGACCTTCTTGAGGG - Intergenic
1029433522 7:100548054-100548076 GGGCCCTGGGACCTTGGGGATGG + Intronic
1030259184 7:107544271-107544293 GGCACCTGGGACCTTGGGGATGG - Intronic
1036562501 8:9908443-9908465 GGATGCTGGGACATTTGTGATGG + Intergenic
1037300947 8:17451375-17451397 AGCCCCTGGGGCCTTCTTGAGGG - Intergenic
1037498413 8:19462626-19462648 GGGTGCTGTGACCTTCCTGATGG - Intronic
1038612012 8:29066852-29066874 GTCTGCTGTGACCTTCGTGTTGG - Intergenic
1041147848 8:54896979-54897001 GTCAGCTGTGACCCTCGTGATGG + Intergenic
1046979742 8:120324052-120324074 GGACACTGGGACCTACTTGAGGG + Intronic
1052263531 9:26545733-26545755 AGCCACTGGGACCTACTTGAGGG + Intergenic
1062049667 9:134440764-134440786 GGGGGCTGGGGCCTCCGTGAGGG + Intergenic
1062234265 9:135500563-135500585 GGCGGCTGGGACCTCCCTGCGGG - Exonic
1199694539 X:150334638-150334660 GGCAGCTGGGGCCTTCCTGGGGG - Intergenic