ID: 1122445548

View in Genome Browser
Species Human (GRCh38)
Location 14:101765195-101765217
Sequence CACTGAAAACACTGAAATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122445548 Original CRISPR CACTGAAAACACTGAAATGT TGG Intronic
901102201 1:6727618-6727640 CACTGAATTAAGTGAAATGTAGG - Intergenic
901133194 1:6975690-6975712 TACTAAAACCACTGAATTGTAGG - Intronic
903608169 1:24590232-24590254 CACGGCAAACACTCAAATGGTGG + Intronic
904583243 1:31563515-31563537 AACTAAAAACACTGACATATTGG - Intergenic
904930526 1:34083337-34083359 CACTTAAAACACAGATATATAGG - Intronic
905163423 1:36058278-36058300 CAGTTAAATCACTGAAACGTGGG + Exonic
905439735 1:37987405-37987427 TACTGAAAACACTGTATTGTAGG + Intronic
905646189 1:39626515-39626537 CTCTGAAATCACTGAAATCGGGG - Exonic
905958899 1:42026463-42026485 CACTGAAAATATTAAAATGTTGG - Intronic
907529558 1:55080619-55080641 CACAGAAAACACTGAAAAGCTGG + Intronic
908399513 1:63757697-63757719 CACCAAAAACTCTGGAATGTGGG - Intergenic
909746073 1:79098804-79098826 AACTGAAAACATCTAAATGTTGG + Intergenic
910075603 1:83274540-83274562 CACTGAAAAGACAGAAATAATGG + Intergenic
910176133 1:84432213-84432235 TACTGAAAACACTTACAAGTGGG + Intergenic
910595424 1:88975450-88975472 CAGTAGAAACACTGAAATGTGGG - Intronic
911136283 1:94444683-94444705 CGCTGAAACCACTGAACTTTGGG - Intronic
912525016 1:110276130-110276152 CACTGAAGACTCTGAAGGGTGGG + Intronic
913038335 1:114997205-114997227 CACTGAGAAAACTGAAATTATGG - Intergenic
915207469 1:154281041-154281063 CATTAAAAACTCAGAAATGTAGG - Intergenic
916358988 1:163946139-163946161 CAATGAAAAAAATGAAATATAGG + Intergenic
916753542 1:167745500-167745522 CACTGATGATGCTGAAATGTTGG + Intronic
917368025 1:174255456-174255478 CACTGGTAACACTGAGATATTGG - Intronic
918428715 1:184436608-184436630 CACTGAATAGACTGAGAAGTTGG + Intronic
918613606 1:186519301-186519323 CAATGAAAGTACTAAAATGTAGG - Intergenic
918641673 1:186848483-186848505 CACTGCAGACATTGAAATGCCGG - Intronic
919364195 1:196636315-196636337 CACTGAAAAAAATAAAATGATGG + Intergenic
921087996 1:211814518-211814540 CATGGAAAGCACTTAAATGTTGG - Intronic
921551692 1:216544489-216544511 CACTGAAAGCTGTGTAATGTGGG - Intronic
923082358 1:230670444-230670466 CAATGATAAAAATGAAATGTAGG + Intronic
923180527 1:231514187-231514209 AACTTAAAACTCTCAAATGTGGG - Intergenic
923375139 1:233354151-233354173 CACTGATAAAACTGGATTGTAGG - Intronic
924017346 1:239741638-239741660 CACTGAAGTCAGTCAAATGTTGG + Intronic
924422910 1:243925763-243925785 CACTAAAAGTACAGAAATGTAGG - Intergenic
924842109 1:247723302-247723324 CAGTGAAAACAGTGAGATGGGGG + Exonic
1063811199 10:9710054-9710076 CACTCATAACACTGGAATTTAGG - Intergenic
1064125878 10:12659521-12659543 CAGTGATAGCACTGAAATATTGG - Intronic
1064644931 10:17451399-17451421 CACTGGAGACACAGAAAGGTGGG + Intronic
1064713699 10:18153306-18153328 CATTGAAAACCCTCAAATGCTGG + Intronic
1066355951 10:34683884-34683906 CCCACAAAACACTTAAATGTTGG + Intronic
1066540422 10:36440815-36440837 CACTGAAAACCATTAAATGTTGG - Intergenic
1068883822 10:62078187-62078209 CATTGAAAACACTGCCATGTTGG + Intronic
1069185089 10:65412409-65412431 CACTTAAATCAGTGAAATCTGGG + Intergenic
1069340349 10:67402566-67402588 CACAGAAAACAGAGAAAAGTAGG + Intronic
1070113732 10:73509219-73509241 CACTGAGAAAACTGGAATATTGG + Intronic
1070226023 10:74507187-74507209 CACTAAAAACACTGTAAACTGGG + Intronic
1071365968 10:84900958-84900980 CAGGGCCAACACTGAAATGTAGG + Intergenic
1074270880 10:111952234-111952256 GACTGAAAAAGATGAAATGTGGG - Intergenic
1074430725 10:113392090-113392112 CAATCAAAAAACTGTAATGTGGG + Intergenic
1074557378 10:114504080-114504102 CACTGAAAACACAAAAAAATTGG + Intronic
1074705702 10:116128223-116128245 CTTTGAAAACAATGAAATGCAGG - Intronic
1075388554 10:122075562-122075584 CACTGAGAACTCAGAAGTGTTGG + Intronic
1076583907 10:131532524-131532546 CACTGCAGAGGCTGAAATGTGGG + Intergenic
1077672211 11:4167003-4167025 CCCTGAAAACACCTTAATGTTGG - Intergenic
1077695380 11:4388504-4388526 CAGTGGAAACACAGAAATCTAGG - Exonic
1078455647 11:11472454-11472476 CAGAGAATACACTAAAATGTTGG + Intronic
1078505512 11:11939114-11939136 CAATGAAAACATTCAAATTTTGG + Intronic
1078982484 11:16552317-16552339 CACTATAAAAACTTAAATGTGGG + Intronic
1079275783 11:19036169-19036191 CACTGACAACACTAAATTCTGGG + Intergenic
1079578941 11:22037843-22037865 CACTGAGAGTACTGAAATATTGG - Intergenic
1083512355 11:63222305-63222327 CAATGAAAACTCTAAAATGTTGG - Intronic
1086765627 11:90692147-90692169 AAATAAAAACAGTGAAATGTGGG + Intergenic
1087130875 11:94668473-94668495 CACAGGTAACACTGACATGTTGG - Intergenic
1088338529 11:108736529-108736551 CACTGACAACATTCAAATTTTGG - Intronic
1088439542 11:109854213-109854235 CACTGGAAACTCTAAAAGGTGGG + Intergenic
1088693213 11:112345378-112345400 CACTGTAAACATTGGAGTGTGGG - Intergenic
1094180881 12:27591482-27591504 TACTGAAAACCCTGAACTTTTGG + Intronic
1094317873 12:29151761-29151783 CAATGAGGAAACTGAAATGTAGG - Intronic
1095209681 12:39477664-39477686 AACAAAAAACACTGAAATATAGG + Intergenic
1096192205 12:49627145-49627167 GACTGAAAACACTGAAGGGCAGG - Intronic
1096363552 12:51008974-51008996 CTCTAAAAACACTGACATATGGG + Intronic
1097379332 12:58876338-58876360 CATTGATAACACTGACATTTAGG - Intronic
1098150696 12:67543438-67543460 CTCTTAAAACTCAGAAATGTGGG + Intergenic
1098382223 12:69881289-69881311 AACTGTAAACACTCAAATGTGGG + Intronic
1099209732 12:79769512-79769534 CACAGAAAATACTAAAATTTAGG + Intergenic
1099708824 12:86193486-86193508 AACTGAAAACACAGAAATACAGG - Intronic
1100852703 12:98729676-98729698 TACTGAAAACATTCAAGTGTAGG + Intronic
1101992492 12:109498711-109498733 CAATGAAAACACTGTAAAATAGG - Intronic
1103107111 12:118238488-118238510 CACTCCAGACATTGAAATGTTGG - Intronic
1104469250 12:129016191-129016213 CACTGAAGACCCTGAAACTTGGG + Intergenic
1104529815 12:129558819-129558841 CATTTATAACATTGAAATGTAGG - Intronic
1104913627 12:132252434-132252456 CAATGGAAAGAGTGAAATGTAGG + Intronic
1107030941 13:35853205-35853227 TAGTGAAAACACTCAAATGGAGG + Intronic
1107398614 13:40046083-40046105 CTCTGACTACACTAAAATGTGGG - Intergenic
1107580451 13:41778287-41778309 TATTAAAAACTCTGAAATGTTGG - Intronic
1108133958 13:47334986-47335008 CTCTGAAAACACTGTTAAGTTGG - Intergenic
1108452760 13:50584146-50584168 CACAGAAAACAATGAAAATTAGG - Intronic
1109104192 13:58228933-58228955 CACTGGAGACTCTGAAATGTGGG + Intergenic
1109574952 13:64243191-64243213 CACTGGAAACACTTCATTGTGGG + Intergenic
1109690633 13:65883404-65883426 CTTAGAAAACACTGAAATATAGG + Intergenic
1110866871 13:80406338-80406360 CACTGAAATCCCTGAAAGGGAGG - Intergenic
1112606112 13:100908592-100908614 CACTGAAACCACTAAAATAAAGG - Intergenic
1113031284 13:105996581-105996603 CACTGCACACCCTGAGATGTGGG - Intergenic
1113179338 13:107607951-107607973 CACTGTCTACACTGAAATGCTGG + Intronic
1114725127 14:24928259-24928281 CATGGAAAAAACTGAAAAGTGGG + Intronic
1115995664 14:39193343-39193365 CACTGAAAACATTCAAAACTGGG - Intergenic
1117411359 14:55454282-55454304 GAGTGTAAACAATGAAATGTAGG - Intronic
1117429224 14:55636224-55636246 AACTGTAAACCCTGTAATGTTGG + Intronic
1117521836 14:56559039-56559061 CATTGAACACACATAAATGTGGG + Intronic
1118179067 14:63472863-63472885 GGCTGACAACACAGAAATGTGGG + Intronic
1118834511 14:69467433-69467455 CACTGAATAGCCAGAAATGTAGG + Intergenic
1122189186 14:100026479-100026501 CACAGGAAAGACTGAAAGGTTGG - Intronic
1122445548 14:101765195-101765217 CACTGAAAACACTGAAATGTTGG + Intronic
1123206200 14:106715567-106715589 CACTGGTAACACTGAAAAGGTGG + Intergenic
1123211283 14:106762977-106762999 CACTGGTAACACTGAAAAGGTGG + Intergenic
1124112774 15:26807656-26807678 GACTGAAGAGACTGAAATGTTGG + Intronic
1125405164 15:39345186-39345208 CAATGAAAGCACTGAAATTTAGG - Intergenic
1126186548 15:45836156-45836178 CACTCAAAACCCTGATAAGTGGG + Intergenic
1126405920 15:48322390-48322412 CAATCAAAACACAGAATTGTAGG - Intergenic
1127438368 15:58980936-58980958 CATTAAAAACACTGATATATTGG - Intronic
1127821968 15:62666252-62666274 CACTGACAACACCCAAATTTTGG - Intronic
1128038525 15:64548992-64549014 ACCTGAAAACCCTGAAATTTAGG + Intronic
1128222810 15:65981068-65981090 GACTGAATACATTGGAATGTAGG + Intronic
1129655692 15:77524158-77524180 CTCAGAAAACAATGATATGTAGG + Intergenic
1130329792 15:82913015-82913037 TACTGAAAACACAGAAAACTGGG + Intronic
1131656981 15:94471169-94471191 AACTGCAATAACTGAAATGTTGG + Intronic
1131776350 15:95803741-95803763 CAATGACAAAACTGAATTGTAGG + Intergenic
1132170185 15:99643332-99643354 AACTGAAAACACTAAAATCAAGG + Intronic
1132172568 15:99676242-99676264 AACAGAAAACAATTAAATGTGGG + Intronic
1133737039 16:8623769-8623791 CACAGCAACCACTTAAATGTAGG + Intronic
1135143504 16:19941328-19941350 CACTGTCTACAATGAAATGTTGG - Intergenic
1135539953 16:23322196-23322218 CACTGTAGGCACTTAAATGTGGG - Intronic
1137013320 16:35345367-35345389 TACTGAAAACTATAAAATGTTGG + Intergenic
1137361024 16:47815232-47815254 CACTGAGGACTCTGAAATGAGGG - Intergenic
1140643765 16:77007469-77007491 TACTAAAAACATTCAAATGTTGG - Intergenic
1141363741 16:83422846-83422868 CAATGAACACTCAGAAATGTTGG + Intronic
1142536801 17:623405-623427 CAGTGAAATCACTGCAATGAGGG + Intronic
1143114210 17:4572427-4572449 TTCTTAAAACACTGGAATGTTGG - Intergenic
1144119280 17:12134869-12134891 CACTGAAACTACTAAAATGCTGG + Intronic
1144135566 17:12291725-12291747 CACTGAAACCAATGAACAGTTGG + Intergenic
1144528634 17:16013744-16013766 ATGTGAAAACAGTGAAATGTGGG - Intronic
1149353267 17:55813422-55813444 TACTGAAAACACAAAAATGTTGG - Intronic
1149592559 17:57842312-57842334 CACTGAAAAATGTTAAATGTGGG - Intronic
1149636249 17:58172299-58172321 CACTGGAAAAACTGAAATTGAGG + Intergenic
1149971227 17:61220404-61220426 AACTGTAAACTCTAAAATGTGGG - Intronic
1152187469 17:78866958-78866980 TACTAAAACCACTGAATTGTAGG + Intronic
1153234195 18:2970238-2970260 CACTGAAATCATTGAAATCCAGG - Intronic
1155302443 18:24442978-24443000 TACTGAAAAAAATGAAATGGGGG - Intronic
1155699142 18:28721760-28721782 CATTGAAAACACTGGAATTGAGG - Intergenic
1155763329 18:29593583-29593605 CACTAAAAACTATGAAATATTGG + Intergenic
1155863322 18:30932217-30932239 CAATGAAAACACGGCATTGTAGG - Intergenic
1156043387 18:32850127-32850149 CACTGAAAACTGCAAAATGTTGG + Intergenic
1156248789 18:35330706-35330728 GACAGGAAAAACTGAAATGTGGG + Intergenic
1156733674 18:40226886-40226908 CACAGAACAAACTGAAATGAAGG + Intergenic
1157485891 18:48086588-48086610 TACTGAGAACCCTGAAGTGTGGG - Intronic
1158241085 18:55379372-55379394 CACTGAAGCCTCTGAAGTGTAGG + Intronic
1159709529 18:71738674-71738696 CACTGAAAACTGTCATATGTTGG + Intronic
1159717498 18:71844531-71844553 CACTCAAAACAGTGGAAGGTGGG + Intergenic
1159829781 18:73261808-73261830 CACTGAAAACACAGAAAGCTAGG + Intronic
1160254125 18:77232986-77233008 CACTGTAAACAATGAATTTTAGG + Intergenic
1162504081 19:11072372-11072394 CATTAAAAAGACTGAAATTTTGG + Intergenic
1163708009 19:18827897-18827919 CAATTAAAACTCTGAAAGGTGGG + Intergenic
1164991978 19:32691497-32691519 CACAGAAAACACCCACATGTGGG + Intergenic
1165279065 19:34781434-34781456 AACTGAAAGCAATGAAATGCTGG + Intergenic
925109459 2:1321577-1321599 CACTGAAAAGACTGAATCGAGGG + Intronic
925279888 2:2676421-2676443 CACTGAACAAATTCAAATGTTGG - Intergenic
928250306 2:29671569-29671591 CACTGGAAAAACTGAAATTGAGG - Intronic
929659162 2:43766320-43766342 CACCAAATACAGTGAAATGTGGG - Exonic
930144068 2:47983113-47983135 CTCTGGAAATACTGAAATGGTGG + Intergenic
930383816 2:50666080-50666102 GACAGAAAACACATAAATGTTGG - Intronic
931670969 2:64646864-64646886 CACTGGAAATTCTGAACTGTTGG - Intronic
931723385 2:65084039-65084061 GACTGAAAAAAGTGAATTGTTGG + Exonic
932531648 2:72540603-72540625 CATTGACAAAATTGAAATGTGGG - Intronic
933695745 2:85215987-85216009 CTCTGAAGAGAATGAAATGTTGG + Intronic
934689271 2:96345887-96345909 GACTGAAAACACTTGAATATAGG + Intronic
935012692 2:99150344-99150366 AAATGTAAACACTGAAAGGTAGG + Intronic
935132545 2:100271380-100271402 CACGGAGAGCACTGAGATGTGGG + Intergenic
936094514 2:109521573-109521595 CAGTGAAAAGAGTGAAATCTCGG - Intergenic
937959993 2:127450539-127450561 CAGTGAAAACAATGTGATGTTGG - Intronic
937965336 2:127503240-127503262 AACTGAACACACTACAATGTGGG - Intronic
938553740 2:132404184-132404206 CAATGAAACCACTGAGATGGGGG + Intergenic
939269303 2:139917134-139917156 CCCTGAAGAAACTGAAAGGTTGG + Intergenic
939276491 2:140004374-140004396 TATAGAAAACACTGAAATGTAGG - Intergenic
939752604 2:146065612-146065634 AACTGGAAAAACTGAAAAGTAGG + Intergenic
939755931 2:146110579-146110601 AGCAGAAAAGACTGAAATGTTGG + Intergenic
939949866 2:148456795-148456817 AACTGAAAACAGGGAACTGTGGG - Intronic
941909277 2:170747474-170747496 AACTGAAAACACTTCAATGTGGG + Intergenic
941966766 2:171308252-171308274 TACTGAGAATACTGAAATGCAGG - Intergenic
942425204 2:175852799-175852821 CACTTAAGACAATGAAATGATGG - Intergenic
942826093 2:180178801-180178823 TTCTGGAAACACTGAATTGTTGG - Intergenic
943795239 2:191984490-191984512 CAATGAAATCCCTGAAATGAGGG + Intronic
944116109 2:196187878-196187900 CACAAAAAACATTAAAATGTAGG - Intergenic
944333231 2:198497552-198497574 TACAGAAAACACTGAAATTTGGG - Intronic
944521224 2:200569515-200569537 CAATGAAGACACTTAAAGGTAGG - Intronic
944930547 2:204514495-204514517 TTCTGAAAACAGAGAAATGTTGG - Intergenic
947297934 2:228653839-228653861 CACTGACAAGAAAGAAATGTTGG - Intergenic
948029455 2:234805099-234805121 CACAGACTACACAGAAATGTAGG + Intergenic
1169686626 20:8281174-8281196 CACTCAAAACAATGTCATGTTGG + Intronic
1169705496 20:8498954-8498976 CACTCAAAAGAATGAAATGAAGG - Intronic
1171107134 20:22445330-22445352 CCCTGAGAACTCTGAAATGGAGG + Intergenic
1171168650 20:22995673-22995695 AACTGAAACAAATGAAATGTTGG + Intergenic
1171570258 20:26243075-26243097 AAATGAAAAAACTGAAAAGTAGG + Intergenic
1171953556 20:31441951-31441973 CATTGAACACACTGAAATTTTGG + Intronic
1173955955 20:47032873-47032895 CTGTGAAAACAGTGAAATGTGGG - Intronic
1176948948 21:15020891-15020913 GACTGAAAAAACTCAAAGGTTGG + Intronic
1177128255 21:17223499-17223521 CACTGAAAACTCTGAAAGCGGGG - Intergenic
1177264671 21:18766868-18766890 CACTGAAGACAGTGAAATTTTGG + Intergenic
1177675510 21:24293855-24293877 CACTGAAAACTCAGAGAGGTTGG + Intergenic
1177840158 21:26227078-26227100 CCATGGAAACAGTGAAATGTGGG + Intergenic
1178457301 21:32767300-32767322 CATTGGTAACACTGAAATGAAGG - Intronic
1178721669 21:35016216-35016238 CACTGAAGACAATGGCATGTTGG - Intronic
1178889392 21:36508748-36508770 CACTGAAAACAGTCACAAGTTGG + Intronic
1179255997 21:39715863-39715885 CACTGAATCAAATGAAATGTGGG + Intergenic
949368751 3:3311611-3311633 CGTTTAACACACTGAAATGTTGG - Intergenic
949872454 3:8600906-8600928 CACTGAAATAACTAAAATGGAGG - Intergenic
950320575 3:12048956-12048978 AACTGAAAAGACTGACATATAGG - Intronic
951688308 3:25369462-25369484 CAATGAAAAAACTAAAAAGTGGG + Intronic
954646843 3:52136825-52136847 GCCTGAAAACACTTGAATGTGGG - Intronic
955868025 3:63406248-63406270 CACTGAAAATACAGGGATGTTGG - Intronic
956261889 3:67352339-67352361 CACATAACACACTCAAATGTTGG + Intergenic
956645870 3:71455541-71455563 TAATGAAAACTCTTAAATGTTGG + Intronic
957836863 3:85605564-85605586 CATAGAAAACACTGAACAGTTGG - Intronic
958069026 3:88585256-88585278 AAATGTAAACTCTGAAATGTAGG + Intergenic
959188305 3:103075630-103075652 CCCTGTAAACACTGTGATGTGGG - Intergenic
959350742 3:105259843-105259865 GACTCAAACCATTGAAATGTAGG - Intergenic
959400845 3:105900349-105900371 CACTGGACACTCAGAAATGTGGG + Intergenic
959688099 3:109169544-109169566 GACTGAACACACTCAAGTGTAGG - Intergenic
959963071 3:112322690-112322712 CACTGTAAATACTGATATTTTGG + Intergenic
961937149 3:130597325-130597347 CACTGATATTACTAAAATGTAGG - Intronic
965440794 3:168711470-168711492 CACTTAATACACTGAAGTTTTGG + Intergenic
965964151 3:174466675-174466697 CAGTGAGAACATTGAATTGTAGG + Intronic
966330461 3:178806284-178806306 CAATGAAAACTCTGCAAGGTGGG - Intronic
966550603 3:181200094-181200116 CTCTGACATCTCTGAAATGTGGG + Intergenic
966646547 3:182251804-182251826 CTTTTGAAACACTGAAATGTGGG + Intergenic
968527368 4:1068544-1068566 CAATGATAACACTGTATTGTTGG - Intronic
971088441 4:23309321-23309343 CATTGAAAACATTCTAATGTAGG + Intergenic
971567522 4:28164384-28164406 CAGTGAAGCCACTGGAATGTGGG + Intergenic
971735877 4:30451429-30451451 CACTGAAAAGGCAGAAATTTAGG - Intergenic
971939320 4:33193757-33193779 CACAGAAAAGACAAAAATGTAGG - Intergenic
972195376 4:36647419-36647441 CACTGAGTTCAGTGAAATGTTGG + Intergenic
972628554 4:40823798-40823820 CACTTACCACACTCAAATGTGGG + Intronic
973082750 4:46014496-46014518 CACTGAAAGCACTGAAAGATGGG - Intergenic
973117759 4:46482616-46482638 CACTGACAACATTTAAATATGGG + Intergenic
974527917 4:63068767-63068789 CACTGAAAACACTAAACATTGGG + Intergenic
974833704 4:67220862-67220884 CTCTGAAATCACTCACATGTGGG + Intergenic
975405613 4:73985460-73985482 CACTGCAAACATTAAAATCTGGG - Intergenic
975545163 4:75553341-75553363 CACTAATAACAAAGAAATGTTGG + Intergenic
977656853 4:99532532-99532554 CACTGGAAACTCCAAAATGTAGG + Intronic
979350567 4:119639817-119639839 CTGTGAAATCACTGAAATGGTGG + Intergenic
979765968 4:124464124-124464146 CTTTGAAAACACTTAAATTTGGG + Intergenic
980433964 4:132744243-132744265 CATTGAAAACATTGTCATGTAGG + Intergenic
980776515 4:137444031-137444053 CAATGTAAACATTGAAAAGTTGG + Intergenic
981027216 4:140088878-140088900 CACTGAAAGCACCGAACTGTGGG - Intronic
981033313 4:140147484-140147506 CACTGAAAAGACCAAAAGGTTGG + Intronic
982388459 4:154838121-154838143 CACTCAAAAAGCTGAAATTTGGG - Intergenic
982919870 4:161259236-161259258 CACTGAATACAACAAAATGTTGG + Intergenic
985743821 5:1635270-1635292 CACTGAAGAAACTGAAAAGCTGG - Intergenic
985876304 5:2600231-2600253 TATTGAAAACACTCAAAAGTAGG + Intergenic
986097692 5:4575899-4575921 CTTTGAAAACTCTGAGATGTTGG + Intergenic
986479767 5:8174927-8174949 CACTGAAACTACTGACATGATGG - Intergenic
986836237 5:11641015-11641037 CACAGTAAACACTGACATGTTGG - Intronic
986925131 5:12738586-12738608 CTCTGAAATAACTGAGATGTTGG + Intergenic
987663860 5:20909964-20909986 CACTGAAAACAATGAACCCTAGG - Intergenic
988637583 5:33003292-33003314 CAATGATAACACTGTATTGTGGG - Intergenic
988758825 5:34292226-34292248 CACTGAAAACAATGAACCCTAGG + Intergenic
990875802 5:60483939-60483961 AGCTGAAACCACTGAAATGTAGG + Intronic
991192541 5:63892061-63892083 CACAGTAAGCACTCAAATGTTGG - Intergenic
992920677 5:81514681-81514703 GAATGAATACACTGAAATATAGG - Intronic
993315505 5:86400636-86400658 CAGTGAAGACACTTAAATGTTGG - Intergenic
993909409 5:93663111-93663133 CACTGATAACACCTAAATTTTGG + Intronic
995516332 5:112957813-112957835 CACTGCAAGCTCTGAAATGTAGG - Intergenic
998300208 5:141010634-141010656 CTGTTAAAACACTGAACTGTTGG - Exonic
998300966 5:141019840-141019862 AACTAAAAACAATGATATGTTGG - Intergenic
998519722 5:142788840-142788862 CACAGAAAACACTTAAATGGTGG - Intronic
1000059307 5:157639100-157639122 GACTGAAAACACATAAATGCTGG + Intronic
1002886823 6:1304547-1304569 CACTGGAAACTCAGAAAGGTGGG + Intergenic
1005685502 6:28249863-28249885 CATGGAAAACATAGAAATGTTGG - Intronic
1005926465 6:30449572-30449594 CACTGAGTCTACTGAAATGTGGG + Intergenic
1006818370 6:36869657-36869679 CACTAAATACACTGAAACGTAGG + Intronic
1007740643 6:44007543-44007565 CATTTAAAAAACTGAAATTTTGG - Intergenic
1008261559 6:49371770-49371792 CATTCAAAACATTGAAAAGTAGG - Intergenic
1010635863 6:78258843-78258865 AGCTGAAAACTCTGAAAAGTTGG - Intergenic
1011160252 6:84381464-84381486 TCCTGGAAACACTGAATTGTTGG + Intergenic
1012193032 6:96303989-96304011 CTGTGAAAACACTGAAAGGAAGG + Intergenic
1012331904 6:98001668-98001690 CACTGAAAAAAGTGAACTGTGGG - Intergenic
1013237889 6:108214896-108214918 CACTCACAACACTGAAATAAAGG + Intronic
1017055775 6:150434441-150434463 CTCTAAAAAAACTGACATGTTGG - Intergenic
1017490302 6:154939097-154939119 TACTAAAAACACAAAAATGTAGG - Intronic
1018584956 6:165347703-165347725 AACTGAAGAACCTGAAATGTGGG - Intronic
1018688991 6:166328557-166328579 CACTGAAGACACTTACATTTTGG - Intronic
1019401230 7:855335-855357 CTCTGAAGACACTGCAAGGTGGG - Intronic
1019862731 7:3675276-3675298 CAGTGAAAACAGCTAAATGTTGG - Intronic
1020501158 7:8922478-8922500 CACTGCAAACACTGAAACAGTGG + Intergenic
1020784638 7:12557924-12557946 CATTGTAAACACTCAAATATTGG + Intergenic
1021911046 7:25386234-25386256 GTCTGTAAACACTGACATGTCGG + Intergenic
1023535362 7:41203096-41203118 AACTGAAAACATTGGAAAGTGGG + Intergenic
1023716964 7:43054410-43054432 CACTGAAAACCCTGATAAGAGGG + Intergenic
1023749166 7:43353696-43353718 CACTGGAAAAAGTGAAATGGAGG + Intronic
1025948773 7:66126568-66126590 CACTGAAAACCCTGTGATGTAGG - Intronic
1027293314 7:76739417-76739439 CACTGAAAAGACAGAAATAATGG + Intergenic
1027641604 7:80740422-80740444 CACAGAAAACAATAAAATGAAGG - Intergenic
1030762757 7:113371495-113371517 CTCTTAAAACACTGAAACATTGG - Intergenic
1031643354 7:124192555-124192577 CACTGGAGACTCAGAAATGTGGG - Intergenic
1035894549 8:3383553-3383575 GAATGAAAACAGTGAAATATGGG + Intronic
1036087844 8:5632900-5632922 CACTGAAACCTCTGCCATGTGGG + Intergenic
1037166639 8:15838458-15838480 CACTCAAAACTCTGAAAAGAGGG - Intergenic
1038333821 8:26630549-26630571 CAGTTACAAAACTGAAATGTGGG - Intronic
1039108503 8:34016162-34016184 TACTAAAAATAATGAAATGTTGG - Intergenic
1039108553 8:34016896-34016918 TACTAAAAATAATGAAATGTTGG + Intergenic
1039914499 8:41849682-41849704 GAATGAAAACACTGAAGTGATGG - Intronic
1039964071 8:42271360-42271382 CCCTGAAAACATTAAAATGCGGG - Exonic
1040375581 8:46821757-46821779 GAGTGAAAACACTCAGATGTTGG - Intergenic
1042388888 8:68210065-68210087 CACTGAAATCACTGAATTTAGGG - Intronic
1043861437 8:85321850-85321872 CACTGAATTCACTGACATTTAGG - Intergenic
1045119526 8:99020882-99020904 CACTTAAAAAACTGAGAAGTTGG - Intronic
1048815062 8:138325174-138325196 AAATGAAAACACTGAGTTGTAGG + Intronic
1049462559 8:142736902-142736924 CAATGAAAACCCTTTAATGTTGG - Exonic
1050113910 9:2243216-2243238 CACAGAAAAGAATGCAATGTAGG + Intergenic
1050812034 9:9760257-9760279 TACTGAAACCACTCAAATGCTGG + Intronic
1051918641 9:22237558-22237580 CACTAAAAAAAAAGAAATGTGGG - Intergenic
1052250691 9:26394029-26394051 CACTGAGAAGAGTGAGATGTAGG - Intergenic
1052770096 9:32679625-32679647 CACTGAGAACATTTAAGTGTGGG - Intergenic
1054739633 9:68791897-68791919 TACAGAAAACACTGAACTGCAGG - Intronic
1055149185 9:72974747-72974769 AATTGAAAACACTGGAGTGTAGG - Intronic
1056004046 9:82248064-82248086 CACTCAAATCAAAGAAATGTAGG - Intergenic
1056648752 9:88439081-88439103 CACACAAAACACAGAATTGTAGG + Intronic
1056803730 9:89712340-89712362 CACTCAGAACACTGGCATGTGGG + Intergenic
1057700071 9:97357509-97357531 CACTGAAAAAAATGAAATCAGGG - Intronic
1058040277 9:100294882-100294904 CACTGATAACCCTGCAAGGTAGG + Intronic
1058453495 9:105118098-105118120 CATTGGAAACTCAGAAATGTGGG - Intergenic
1058560816 9:106226984-106227006 CACTAACAACACTGAAATTCAGG - Intergenic
1058615200 9:106818743-106818765 TACTGAAAACACTGAGGTGCAGG - Intergenic
1058721305 9:107767020-107767042 CACTGCAAACACTGAATTACTGG + Intergenic
1059811959 9:117865086-117865108 CAGTGAAAGCACTTAGATGTGGG + Intergenic
1059897709 9:118886310-118886332 CACTGACAACACTGACAAATTGG - Intergenic
1060139314 9:121193511-121193533 CACTGAATACAAACAAATGTTGG + Intronic
1060240945 9:121902688-121902710 CACTAAAAACACATAAATGGAGG - Intronic
1191130544 X:57003871-57003893 CATTGAAGACTCTGAAAGGTGGG - Intergenic
1191136856 X:57073826-57073848 CACATAAAACAGTTAAATGTAGG + Intergenic
1192242609 X:69345654-69345676 CACTGAAAACTATAAAATGTTGG - Intergenic
1194277270 X:91900640-91900662 CTCATAAAACACTGAAATGATGG + Intronic
1195738174 X:108034580-108034602 CATTCCCAACACTGAAATGTGGG - Intergenic
1196950597 X:120872591-120872613 CAATGAATAAACTGAAACGTGGG - Exonic
1197587423 X:128365479-128365501 CATTTAAAACACTTTAATGTGGG + Intergenic
1198022510 X:132672784-132672806 CACTGAAAATGCTGAAGAGTTGG - Intronic
1200594613 Y:5122738-5122760 CTCATAAAACACTGAAATGATGG + Intronic
1201697966 Y:16847677-16847699 CACTGAACACTCTGTGATGTTGG - Intergenic