ID: 1122445551

View in Genome Browser
Species Human (GRCh38)
Location 14:101765219-101765241
Sequence CCCTTCACTGCTTCCTCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122445547_1122445551 2 Left 1122445547 14:101765194-101765216 CCACTGAAAACACTGAAATGTTG 0: 1
1: 0
2: 6
3: 25
4: 315
Right 1122445551 14:101765219-101765241 CCCTTCACTGCTTCCTCATAAGG 0: 1
1: 0
2: 0
3: 27
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122445551 Original CRISPR CCCTTCACTGCTTCCTCATA AGG Intronic
900901707 1:5521111-5521133 CTCCTCCCTGCGTCCTCATATGG + Intergenic
901095390 1:6674899-6674921 CCCTTCACTGACTACCCATATGG + Intronic
901126290 1:6931004-6931026 CTGTTCTCTGGTTCCTCATAAGG + Intronic
903354938 1:22740800-22740822 CCCCTCCCTGCTTCCTGATGTGG + Intronic
903827574 1:26156785-26156807 CCCTTCACAGCTCCCTTCTAGGG - Intergenic
904462436 1:30688077-30688099 CCCTCCCCTGCTGCCTCATTTGG - Intergenic
904809448 1:33153647-33153669 CCCTTCTCAACTCCCTCATAAGG - Intronic
904904590 1:33885567-33885589 CCCATTCCTGCTTCCTCATGTGG - Intronic
907188726 1:52631997-52632019 CCCTCCCCTGCTTCCTCAGATGG + Intergenic
907377489 1:54055756-54055778 TCCTTCACTGCTTTCCAATATGG - Intronic
908503142 1:64764804-64764826 AACTTCACTTCTTGCTCATAAGG + Intronic
908832017 1:68188786-68188808 CCATTCTCTGCATCCTCAAAAGG - Intronic
909837346 1:80273695-80273717 CCTTTCACTGTGTCCTCACATGG - Intergenic
915065348 1:153220053-153220075 CCCTCCACCTCTTCCTCATGAGG - Intergenic
915568664 1:156731875-156731897 CCCAGCACTGCTGCCACATAGGG - Intronic
920091420 1:203455715-203455737 CCCTTCACAGATGCCTCATCAGG + Intergenic
920662218 1:207924965-207924987 GCCTTCACAGCTTCCACATTTGG - Intergenic
920718058 1:208359870-208359892 CCTTTCTCTTCTTCCTCATCAGG - Intergenic
921254436 1:213326589-213326611 CCCTTCCCTGTTTCCTCTTCAGG + Intergenic
921718979 1:218449771-218449793 CTTTTCACTGCATCCTCACATGG + Intergenic
921799710 1:219388205-219388227 AAATTCAATGCTTCCTCATATGG + Intergenic
922084739 1:222335499-222335521 ACCTTCACTGCTTAATAATATGG + Intergenic
922169681 1:223143901-223143923 CACTCCACCGCTTTCTCATAAGG - Intergenic
923257733 1:232235573-232235595 GCCTTCTCTGTGTCCTCATATGG + Intergenic
1064181597 10:13121151-13121173 CAGTTAACTCCTTCCTCATATGG - Intronic
1064600874 10:16991225-16991247 CCTTTCATTGAGTCCTCATATGG + Intronic
1067524585 10:47030432-47030454 CCCTTCTCTGCAGCCTCACAGGG + Intergenic
1068671250 10:59725771-59725793 TACCTCACTGCTTCCTCATTTGG - Intronic
1068931473 10:62594652-62594674 TCCTACCTTGCTTCCTCATAAGG - Intronic
1071923654 10:90379989-90380011 CCCTCTACTCCTTCCTCATATGG - Intergenic
1071924945 10:90395436-90395458 CTTTTCACTGTTTCCTCACATGG + Intergenic
1073349941 10:102812621-102812643 CGGTTCACCACTTCCTCATAAGG - Exonic
1074336396 10:112580697-112580719 CCTTTCACTGCCTCCCCATCTGG - Intronic
1078562347 11:12384078-12384100 CCCTTCTCTCCTTGCTCATAAGG + Intronic
1079989613 11:27232970-27232992 CTTCTCACTGCATCCTCATAGGG + Intergenic
1080964341 11:37196560-37196582 CCCCTCACTGCCTCCACAAAGGG + Intergenic
1081880220 11:46443598-46443620 TCTTTGACTTCTTCCTCATAAGG - Exonic
1082760218 11:57120134-57120156 CTTCTCACTGCTTCCTCACATGG - Intergenic
1082867696 11:57914694-57914716 CCTCTCACTGCATCCTCACATGG + Intergenic
1083320263 11:61841653-61841675 CCATTCTCTCCTTCCTCATCTGG + Intronic
1084700527 11:70783864-70783886 CCCTTCACTCCTTCCTCTTCCGG - Intronic
1088456438 11:110037268-110037290 ATCTTGACTGATTCCTCATAAGG - Intergenic
1089372294 11:117969931-117969953 CCCTGCCCTGCATCCTCCTAAGG - Intergenic
1089748244 11:120631991-120632013 CCCTTCCAAGCTTCCTCATCTGG + Intronic
1091097579 11:132838802-132838824 AGCTTTGCTGCTTCCTCATAGGG - Intronic
1091099546 11:132858252-132858274 CCCTGCTCTGCTTCCTCTGATGG + Intronic
1091449669 12:564681-564703 CTCTTCTCTGCTTCCTCAACAGG - Exonic
1091451307 12:573775-573797 CCCTGCACTGCTGCCTCAGAAGG + Intronic
1094304962 12:29008534-29008556 CCTCTCACTGTATCCTCATATGG + Intergenic
1095394250 12:41744128-41744150 CCCTTACCTGGTTACTCATAGGG - Intergenic
1096527130 12:52217011-52217033 CCCTTCACTGTTTCCCCAGCAGG - Intergenic
1101126049 12:101634364-101634386 CCCTTCATTGGTTCTTCATGAGG + Intronic
1105074992 13:16004166-16004188 CCCTTCACAGATTCTACATAAGG - Intergenic
1105601494 13:21892293-21892315 CCCCTCACTCCTTCCTCATCAGG + Intergenic
1106864719 13:33950928-33950950 CCCTTCACTTATTCCTCATGTGG + Intronic
1109426694 13:62173615-62173637 CCTGTCACTGCTTCTTCATAAGG - Intergenic
1111677024 13:91399579-91399601 CGGTTTACTGCTTTCTCATAAGG + Intronic
1111802497 13:92997681-92997703 CTCTTCACTGTGTCCTCACATGG + Intergenic
1112243173 13:97702316-97702338 CATCTCACTGCATCCTCATATGG + Intergenic
1113601958 13:111575833-111575855 CTTTTCACTGTGTCCTCATATGG + Intergenic
1114524202 14:23358236-23358258 ACCTTCACTGCAGCCTCATGAGG - Intronic
1115388785 14:32829760-32829782 GCCTTCAATGGTTCCTCAAAGGG + Intronic
1116520674 14:45843071-45843093 CCCGTTACTATTTCCTCATATGG - Intergenic
1116992013 14:51286678-51286700 CCCTTTACTCCTGCCTCAGAAGG - Intergenic
1117466839 14:56002199-56002221 ACATTCTGTGCTTCCTCATAGGG - Intergenic
1118027467 14:61784036-61784058 CCCTCCACTGCTTCAATATAGGG - Intronic
1119520578 14:75281417-75281439 CCCTTCCCTGCCCCCTCACAGGG - Exonic
1119553174 14:75531788-75531810 TCCTTCTCTGCCTCCTCAGAAGG - Intronic
1120634071 14:86929514-86929536 CTCCTCACTGCATCCTCATATGG + Intergenic
1121372918 14:93376983-93377005 TCCTTCACTGATCCCTCAAAGGG - Intronic
1121734285 14:96206941-96206963 ACCTTCTATGCATCCTCATATGG + Intronic
1122445551 14:101765219-101765241 CCCTTCACTGCTTCCTCATAAGG + Intronic
1125505751 15:40266593-40266615 CCCTGGACTGCTTCCGCCTAAGG + Intronic
1125897527 15:43315151-43315173 CCCTTCCCTGTTCCCTCATGTGG - Intergenic
1127450343 15:59110389-59110411 TCCTTCACTACTTTCTCAGAGGG - Intronic
1127969765 15:63949207-63949229 CCCATGACTGCTTCCTCCTCTGG + Intronic
1127998760 15:64171680-64171702 TCCTCCACTGCTTGCCCATAGGG - Exonic
1128162329 15:65431804-65431826 TCCTGCACTGCTTTCTCTTAGGG + Intergenic
1128523509 15:68391083-68391105 CCCCTCCCTGCTTCCTCTTCTGG - Intronic
1128623609 15:69175794-69175816 GCTTTCACTGCTTCTTCATGTGG + Intronic
1128745402 15:70110823-70110845 CCCTTCAGAGCTGCCTCAAAAGG - Intergenic
1129281128 15:74485884-74485906 CTCTTCACTGTAGCCTCATAGGG - Intergenic
1132073681 15:98801357-98801379 CCCTGCACTGCTTCCTGCTGGGG + Intronic
1132137046 15:99351568-99351590 TGCTTCACTTCTTCCTCATGAGG + Intronic
1132355950 15:101171414-101171436 CCCTTCTCTGCTTCCCTGTATGG + Intergenic
1135568169 16:23528054-23528076 CCCTTCGCTGCATCCTCACGTGG - Intronic
1135930817 16:26734967-26734989 CTCTAAACTGCTTCCTCCTAGGG + Intergenic
1136509140 16:30725005-30725027 CCCTCCACTGCTACCTCGTTTGG + Exonic
1136608539 16:31352614-31352636 CCCTGCACTACTTCCTCTTTTGG + Intergenic
1138023776 16:53506319-53506341 CCCTTCAGTGGTTCCCCATTGGG + Intergenic
1139924528 16:70478862-70478884 CCCCTCTCTGCTTCCTGTTAGGG - Intronic
1140683197 16:77405759-77405781 CTTTTCACTGTTTCCTCACATGG + Intronic
1140737696 16:77912871-77912893 CTTCTCACTGCTTCCTCATATGG + Intronic
1141023712 16:80523069-80523091 CTACTCACTGCGTCCTCATATGG + Intergenic
1142418223 16:89954593-89954615 CCCATCACTGCTGCATCCTAGGG + Intronic
1142698400 17:1645752-1645774 CCCCTCCCTGCTTCCTCTCAGGG + Intergenic
1142950535 17:3475468-3475490 CCCTTCATTTCTTTCTCATGAGG - Intronic
1143908115 17:10226059-10226081 ACCTTCTGTGTTTCCTCATATGG + Intergenic
1146553791 17:33805466-33805488 AGCCTCACTTCTTCCTCATAGGG + Intronic
1149301154 17:55305520-55305542 CACTTCACTTCCTCCTCATGGGG - Intronic
1150208479 17:63427770-63427792 CCCATCACTGCATCCTCAGGAGG - Intergenic
1150466338 17:65395883-65395905 CTTTTCACTGCGTCCTCACAGGG - Intergenic
1150507267 17:65712081-65712103 CCCTTCCCTGCTTGGTCAGAGGG + Intronic
1150907396 17:69352269-69352291 CTTTTCACTGTGTCCTCATATGG - Intergenic
1152138819 17:78524502-78524524 CCTCTCACTGCATCCTCATGTGG - Intronic
1152177474 17:78797407-78797429 CCCTCCCCTGCTTCCTCAGCGGG - Exonic
1153005616 18:496444-496466 CCCTTCACTGATTGGTAATAGGG - Intronic
1154057453 18:11025169-11025191 CTCTGCCCTGCTTCCTCATCCGG + Intronic
1155740746 18:29284909-29284931 CCTTTCACTGTGTCCTCACAAGG - Intergenic
1156719585 18:40053674-40053696 ACCTTAACTCCTACCTCATATGG - Intergenic
1160082487 18:75742219-75742241 CTTCTCACTGCTTCCTCACATGG + Intergenic
1160355173 18:78221630-78221652 CCCCTCCCTCCTTCCTCATCTGG + Intergenic
1160549056 18:79681351-79681373 GCCTTCACGGCTTCCTCAGTGGG + Intronic
1161512498 19:4679404-4679426 CCCTTCACTGCTGCCTCCTCAGG + Intronic
1163314391 19:16532296-16532318 CCCTGCACTCCTTCCTCTCATGG - Intronic
1163792461 19:19315656-19315678 CCTTTCTCTGCTTCCTCAGTGGG + Intronic
1166753029 19:45173776-45173798 CCCCTCACTCCTTCCTCCTGGGG - Intronic
1167645244 19:50702266-50702288 CACTTCACTGCCTCCTGACAGGG + Intronic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
925323589 2:2997645-2997667 CCCTTCACTTCCTCCTCCTCTGG + Intergenic
926961870 2:18365826-18365848 CTTTTCACTGCATCCTCACATGG - Intergenic
927516123 2:23672561-23672583 CCCACCCCTCCTTCCTCATAAGG + Intronic
928434374 2:31244657-31244679 TCCTTCCCTGCTCCCTGATAAGG - Intronic
928568128 2:32574647-32574669 CTCATCACTTCTTCCTCATTAGG - Intronic
932141901 2:69286416-69286438 CACTTCACTCCTTCCACACATGG + Intergenic
932441932 2:71743079-71743101 CCCTTCTCTGCTTTGTCATGAGG - Intergenic
934817960 2:97346721-97346743 CCCTTCTCTGCATCCTCACATGG + Intergenic
934819736 2:97361763-97361785 CCCTTCTCTGCATCCTCACATGG - Intergenic
937771214 2:125722489-125722511 GCCTGCACTTCTTCCCCATAAGG - Intergenic
938792924 2:134692615-134692637 CTCCTCACTGCGTCCTCACACGG + Intronic
939444926 2:142296959-142296981 TCCTTCATTACTTCCTTATAAGG + Intergenic
944051096 2:195470776-195470798 CTCCTCACTGTGTCCTCATATGG - Intergenic
944409939 2:199430162-199430184 CCTTTCAGTTCTTCCCCATAAGG - Intronic
944954162 2:204788318-204788340 CCCTACACTGTTATCTCATAGGG + Intronic
944956134 2:204811569-204811591 CACTCCAATGCTTCCTCATCAGG - Intronic
945072103 2:206001900-206001922 CCCTTCTCTGCTTTCTAGTAAGG - Exonic
946337636 2:219049281-219049303 CCCTATTCTGCTTCCCCATACGG + Intergenic
946823746 2:223655704-223655726 CCCTTCTCTGTGTCCTCAAATGG - Intergenic
947356460 2:229300884-229300906 CCCTTCACAACTTCCTCAGTAGG + Intergenic
947388996 2:229620885-229620907 CTTTTCACTGTGTCCTCATACGG - Intronic
947913598 2:233818260-233818282 CCCCTCACTGCTCCCTCTGATGG - Intronic
948057222 2:235017723-235017745 CCCTCCCCTGCTTTTTCATATGG + Intronic
948888430 2:240895594-240895616 ACCTTCACTGCCTCCTCGGAGGG - Exonic
1169861954 20:10162100-10162122 ATCTTCCCTGCTTCCTCTTATGG - Intergenic
1173307317 20:41862784-41862806 ACCTTCACAGCAGCCTCATAAGG - Intergenic
1173362004 20:42353091-42353113 CCCTTCAGCGCTTCTTCATTTGG + Intronic
1176761202 21:10793565-10793587 CCCTTCACAGATTCTACATAAGG - Intergenic
1178352764 21:31884646-31884668 CTTTTCACTGAGTCCTCATATGG - Intronic
1180786311 22:18549695-18549717 CCCCTCCCTTCTTCCTCATGAGG + Intergenic
1181131592 22:20735421-20735443 CCCCTCCCTTCTTCCTCATGAGG + Intronic
1181243232 22:21489248-21489270 CCCCTCCCTTCTTCCTCATGAGG + Intergenic
1183562151 22:38583678-38583700 CCCTGCCCTGCTTCACCATATGG - Intronic
949507635 3:4742035-4742057 CCCCTCACAGCTTCCGCAGAAGG - Intronic
952911908 3:38197396-38197418 TCCTTCACTTCTTCCTCACTTGG + Intronic
954915333 3:54144380-54144402 CCCCTCAGAGCATCCTCATAAGG + Intronic
955023957 3:55149086-55149108 CTGTTCACTGCTTCCTTCTATGG - Intergenic
955348052 3:58175405-58175427 TCCTTCTCTGCTTCGTGATAAGG + Intergenic
955393408 3:58537209-58537231 CCCTTCTCTCCTCCCACATAGGG + Exonic
955959851 3:64328969-64328991 CCCAGCACTGCTTCCCCATCAGG + Intronic
956016493 3:64889284-64889306 CCCATCACTGCTAGCTCCTAAGG - Intergenic
956571858 3:70705562-70705584 CTATTCACTGCATCCTCACATGG + Intergenic
957436768 3:80187544-80187566 CTCTTCACTGCTTCCTAAATGGG + Intergenic
959028836 3:101273643-101273665 CCCTGTACTGCTTCCCCAAAAGG + Exonic
959206467 3:103313268-103313290 ACCTTCTCTGATTCCTCATTTGG - Intergenic
960206165 3:114902097-114902119 ACCCTCACTGCTTCCTCAAAGGG + Intronic
962923883 3:139974460-139974482 CCTTTCCCTGCTTCCCCAGAGGG + Intronic
963059705 3:141215332-141215354 CTTTTCACTGCGTCCTCACATGG + Intergenic
964291983 3:155191469-155191491 CTTTTCACTGTTTCCCCATATGG - Intergenic
964459352 3:156905712-156905734 CCATTCCCTGCTTCCTTAAAAGG + Intronic
964507657 3:157417250-157417272 GTCTTCAGTGCTTCCTCATTGGG + Intronic
966131370 3:176644088-176644110 CACTTAACTGTGTCCTCATATGG - Intergenic
966926178 3:184646022-184646044 CCCTCCACTGGTGCCTCAAAAGG - Intronic
967015706 3:185479827-185479849 ACCTTCTCTGTTTCCTCACATGG + Intronic
968322527 3:197783034-197783056 CCTTTCACTGATTTCTTATATGG + Exonic
968632441 4:1659040-1659062 TCCTTCACTGCTTCCTGTAAAGG + Intronic
968762472 4:2449786-2449808 CCCTTCACACATCCCTCATATGG - Intronic
970559061 4:17265175-17265197 CTTTTCACTGCATCCTCACAAGG + Intergenic
970971515 4:21989695-21989717 CCCTTGACTGATTTCTCATTAGG + Intergenic
974352062 4:60761168-60761190 CATTTCACTGTATCCTCATATGG - Intergenic
976467575 4:85388182-85388204 CCTTTCACTGTGTCCTCACATGG - Intergenic
977440358 4:97058658-97058680 CCCTTCAATGCTGCCTTAGAGGG - Intergenic
977705552 4:100066562-100066584 CCCTTCAATGGTCCCTGATATGG - Intergenic
977705751 4:100068313-100068335 CCCTTCAATGGTCCCTGATATGG - Intergenic
977836895 4:101655896-101655918 CTCTTCACTGCTTCCTGAGATGG + Intronic
980294513 4:130894055-130894077 ACCTTGACTGCAGCCTCATAAGG - Intergenic
980546413 4:134269498-134269520 CCCTTTATTGCTGTCTCATATGG - Intergenic
985139890 4:186829030-186829052 CTCCTCACTGCATCCTCACATGG - Intergenic
985217126 4:187665671-187665693 CTCATCACTACTTCCTCATTTGG - Intergenic
985301444 4:188494299-188494321 CTCTTAACAGCTTCCTCATTTGG - Intergenic
987968484 5:24909235-24909257 CCTTTCACTGTGTCCTCATATGG + Intergenic
988151076 5:27381306-27381328 CCTTTTGCTGCTTCCTCACATGG - Intergenic
993565058 5:89463774-89463796 CCCTTCAGTGTTCCCTCATGTGG - Intergenic
993639332 5:90382908-90382930 TCCCTCACTGTGTCCTCATATGG + Intergenic
993788592 5:92176990-92177012 TCCTTCACTGCTTACACATTTGG + Intergenic
995189843 5:109308633-109308655 ACCTTCCCAGCTTCCTCATATGG - Intergenic
995288044 5:110414556-110414578 CCATTCAGTTCTTCCTCATGAGG + Intronic
995512010 5:112919660-112919682 CTTCTCACTGCTTCCTCACATGG - Intronic
995625447 5:114071299-114071321 CCCATCACAGCTGCCTCAGAAGG + Intergenic
996122037 5:119683574-119683596 AGCTTCACTGCTTCCTTATATGG - Intergenic
996575668 5:124974547-124974569 CCCCTCACTGCTTCATTATGCGG + Intergenic
996609045 5:125357809-125357831 CCCTGCACAGCTTCCTGGTAGGG - Intergenic
998581174 5:143377604-143377626 CGCTGCACTGCGTGCTCATAGGG - Intronic
999297231 5:150467312-150467334 CCTCTCACTGCATCCTCACATGG - Intergenic
1000555687 5:162723280-162723302 CTCCTCACTGTTTCCTCACATGG + Intergenic
1001286935 5:170430683-170430705 TCCTTCACTGGTTCCTGATGAGG - Intronic
1002337802 5:178492392-178492414 GCCTTCCCTGCGTCCTCACACGG - Intronic
1003303903 6:4909268-4909290 CCCTTCCCTGATTCCTCACATGG - Intronic
1005309918 6:24549376-24549398 CTCCTCACTGCATCCTCACATGG - Intronic
1005384337 6:25271132-25271154 CCCTGCACAGCTGCCTCAGATGG - Intergenic
1008402472 6:51079593-51079615 CCTTTGACTGTTTCTTCATATGG + Intergenic
1009324456 6:62332637-62332659 CTCCTCTCTGCATCCTCATATGG - Intergenic
1009338712 6:62526927-62526949 CTTTTTACTGTTTCCTCATATGG - Intergenic
1009719273 6:67444696-67444718 GCCTCCACTGCTTCTTCCTATGG + Intergenic
1009973645 6:70651109-70651131 GCCTTCTCTGTGTCCTCATATGG + Intergenic
1009994313 6:70881697-70881719 CCCTACACAGCTTCCTCGCATGG - Intronic
1011841064 6:91499552-91499574 CCTTACACTGTGTCCTCATATGG + Intergenic
1011890323 6:92151230-92151252 CTTTTCCCTGCATCCTCATATGG + Intergenic
1013133150 6:107254729-107254751 GCTTTCACTGCTTCTTCATCTGG + Intronic
1013212922 6:108002807-108002829 CCCCTCCCTCCTTCCCCATAGGG + Intergenic
1018782191 6:167078291-167078313 GCCTTCACTGCATCCTCACAGGG + Intergenic
1023542736 7:41283403-41283425 CCCCTCCCTGCTTCCTGATCCGG - Intergenic
1023770856 7:43555434-43555456 CTCTTCAGTGCTTCCTGATCAGG - Intronic
1024132069 7:46363224-46363246 CTCCTCACTGCATCCTCATATGG + Intergenic
1024269543 7:47632166-47632188 CCAGTCACTTCTTCCTCATCAGG - Intergenic
1024987547 7:55208591-55208613 CCCTTCTCTGATCCCTCATGGGG - Exonic
1025532982 7:61913395-61913417 CCCTTCACAGATTCTTCAAAAGG - Intergenic
1026945760 7:74314962-74314984 CTCTTCTGTGCTTCATCATAAGG + Intronic
1028789214 7:94834485-94834507 CCCTTCACTTTATCCTCATGTGG + Intergenic
1031609534 7:123808831-123808853 CTTTTCACTGTTTCCTCACATGG + Intergenic
1032690085 7:134277012-134277034 CCGTTCCCAGCATCCTCATAAGG + Intergenic
1034323971 7:150212773-150212795 CCCTTCACTGCGTGCTCAGATGG + Intergenic
1034769226 7:153756464-153756486 CCCTTCACTGCGTGCTCAGATGG - Intergenic
1035388740 7:158491053-158491075 CCAGTCACTACTTCCTCATGAGG + Intronic
1036180659 8:6581865-6581887 GCCTTCTCTGCGTCCTCACATGG + Intronic
1036223418 8:6939575-6939597 GAACTCACTGCTTCCTCATAGGG - Intergenic
1036227495 8:6971871-6971893 GAATTCACTGCTTCCTCAGAGGG - Intergenic
1036229952 8:6991031-6991053 GAATTCACTGCTTCCTCAGAGGG - Intergenic
1036232404 8:7010134-7010156 GAATTCACTGCTTCCTCAGAGGG - Intronic
1036236290 8:7042319-7042341 GAACTCACTGCTTCCTCATAGGG - Intergenic
1037598523 8:20374254-20374276 CTCTTCACTGTTTCCTGATGTGG - Intergenic
1039558409 8:38493647-38493669 CCCCTCCCTGCTTCCACAGAGGG - Intergenic
1040136145 8:43856292-43856314 CCCTTCACAGATTCTTCAAAAGG - Intergenic
1040281245 8:46047191-46047213 CCCTTCACTGATTCTACAAAAGG - Intergenic
1041892041 8:62879974-62879996 CTCTTCATTGCTTCCTAATAAGG - Intronic
1042273972 8:66984307-66984329 TTCTTCACAGCTTCCTCATCAGG + Intronic
1042974959 8:74458503-74458525 CCTTGCACTGCTTCCTCATTTGG - Intronic
1043257516 8:78155213-78155235 CCATTCAATGGTTCCTAATAGGG - Intergenic
1044457500 8:92404905-92404927 TCCCTCACTGCTTTCTCATGGGG + Intergenic
1045895431 8:107210264-107210286 CCCTTCACTTGTACCTCACATGG + Intergenic
1045910374 8:107400500-107400522 CCAATCACTGCTTCCTCAGCAGG + Intronic
1046079428 8:109353334-109353356 CTTTTCACTGCATCCTCACATGG + Intergenic
1047972825 8:130100149-130100171 CCTTTCTCTGCATCCTCATCAGG + Intronic
1048319013 8:133384145-133384167 CCCATAAATGCTACCTCATAGGG + Intergenic
1048327741 8:133452043-133452065 CCTTTCACTGCAGCCTCACATGG + Intergenic
1048367480 8:133750920-133750942 CTTTTCACTGCATCCTCATGTGG - Intergenic
1048833602 8:138498032-138498054 CCATTCCCTGCTTCCTCCTGGGG - Intergenic
1049118294 8:140709807-140709829 CCTTTCTCTCCTTCCTCATTAGG - Intronic
1049155650 8:141065244-141065266 CCCTTCCCTGCCTTGTCATATGG - Intergenic
1049167706 8:141136905-141136927 CCCCTCACTGCCTCCTCTTGTGG + Intronic
1054824244 9:69555985-69556007 CACTTAACTGCTTCCTCTTTTGG - Intronic
1056196917 9:84238041-84238063 CTCTCCACTGCCTCCTCTTATGG - Intergenic
1057746946 9:97759967-97759989 CCCATGGCTGCTTCCTCATAGGG + Intergenic
1058523469 9:105834825-105834847 CCCTACTCTGCTTCCTCCTGTGG + Intergenic
1059210401 9:112509499-112509521 GCCTTCAGTGTTTCCTCATTTGG - Intronic
1061203566 9:129150575-129150597 CCCTCCACATCTTCCTCCTAGGG - Intergenic
1061750310 9:132772484-132772506 CCTCTCACTGCATCCTCACATGG - Intronic
1062228836 9:135469711-135469733 CCCCTCACTGTTTGCTCACAAGG + Intergenic
1188720256 X:33514542-33514564 ACCTTCACAGCTACCTCATGAGG - Intergenic
1191880458 X:65839642-65839664 CCCTCCACTGCTTTCTTAGAGGG - Intergenic
1192523570 X:71823136-71823158 CCTTTAACTGCTGCCTGATATGG + Intergenic
1198391537 X:136180210-136180232 CCCTTCCCCGCTTCGTTATATGG + Intronic
1199473993 X:148226130-148226152 CCCTTCTCTGGTTCCTCAGATGG + Intergenic
1199719099 X:150529373-150529395 CCCTGCACTGCTTCCCCAGGGGG - Intergenic