ID: 1122445727

View in Genome Browser
Species Human (GRCh38)
Location 14:101767001-101767023
Sequence ATTCGTTTTAAGCACATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122445726_1122445727 20 Left 1122445726 14:101766958-101766980 CCAATGTTACATTTTTAGAAGTG 0: 1
1: 0
2: 2
3: 39
4: 384
Right 1122445727 14:101767001-101767023 ATTCGTTTTAAGCACATTAAAGG 0: 1
1: 0
2: 0
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122445727 Original CRISPR ATTCGTTTTAAGCACATTAA AGG Intronic