ID: 1122447549

View in Genome Browser
Species Human (GRCh38)
Location 14:101781021-101781043
Sequence GAACCATGGAATGCAGCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122447542_1122447549 12 Left 1122447542 14:101780986-101781008 CCTCTCTGTAAGCTAAGGATGCG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1122447549 14:101781021-101781043 GAACCATGGAATGCAGCGTGGGG 0: 1
1: 0
2: 0
3: 6
4: 90
1122447539_1122447549 27 Left 1122447539 14:101780971-101780993 CCTGAGCCTTGCTTTCCTCTCTG 0: 1
1: 0
2: 10
3: 64
4: 523
Right 1122447549 14:101781021-101781043 GAACCATGGAATGCAGCGTGGGG 0: 1
1: 0
2: 0
3: 6
4: 90
1122447540_1122447549 21 Left 1122447540 14:101780977-101780999 CCTTGCTTTCCTCTCTGTAAGCT 0: 1
1: 0
2: 4
3: 46
4: 472
Right 1122447549 14:101781021-101781043 GAACCATGGAATGCAGCGTGGGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122447549 Original CRISPR GAACCATGGAATGCAGCGTG GGG Intronic
900528458 1:3140801-3140823 GTACCATGGAACGCAGGATGCGG - Intronic
901313163 1:8285293-8285315 GAACCATGCAGGGCAGGGTGGGG + Intergenic
922510687 1:226164400-226164422 AAACCATGAAATGGAGCATGAGG + Intronic
1062897243 10:1113403-1113425 GAACCATGGGCTGCAGAATGGGG - Intronic
1063086431 10:2822450-2822472 GAGCCATGTGATGCAGGGTGGGG - Intergenic
1066065447 10:31758236-31758258 GAAGCATGGAGTGCAGCTTGAGG - Intergenic
1067715875 10:48690995-48691017 GCACCATGGAAGGCAGCAGGGGG - Intronic
1070642559 10:78180157-78180179 GAGCCAGGGAATGCAGGCTGAGG - Intergenic
1072605297 10:96976356-96976378 GAACAATGTAATACAGCATGTGG - Intronic
1072905224 10:99446830-99446852 GAACCATTCAGTGCAGTGTGAGG + Intergenic
1075435493 10:122437583-122437605 GAACCATGGAATGAGCCCTGGGG + Exonic
1081558846 11:44193791-44193813 GAAGCAGGGAAGGCAGCATGGGG - Intronic
1081999548 11:47386353-47386375 TAACAATGGAATGCTGGGTGCGG - Intergenic
1082081196 11:48013748-48013770 GAACCATGTGATGCACCCTGTGG + Intronic
1084189448 11:67492342-67492364 GGACCGTGGAGGGCAGCGTGTGG - Intronic
1086820822 11:91433842-91433864 GAACAAAGGAAAGCAGGGTGCGG - Intergenic
1091140121 11:133227665-133227687 GAAACAGGGAATCCAGCCTGAGG - Intronic
1092933550 12:13339543-13339565 CAACCTTGGAATTCAGTGTGTGG + Intergenic
1097572929 12:61356182-61356204 GCACCATGGAAGGCAGCAGGAGG - Intergenic
1105215731 13:18283754-18283776 GATCCATGGCATGCACCCTGAGG - Intergenic
1105790142 13:23790611-23790633 GAAGCAGAGAATGCAGCCTGTGG + Intronic
1113373084 13:109740318-109740340 GCACCATGGGATGCAGCCAGTGG + Intergenic
1119643424 14:76330843-76330865 GAATCTGGGAATGCAGGGTGGGG + Intronic
1121406970 14:93725092-93725114 GGACCCTGGAAGGCAGGGTGAGG + Intronic
1121429600 14:93877688-93877710 GAACCTGGGAATGCTGCTTGGGG - Intergenic
1122055487 14:99095287-99095309 GGCCCACGGAATGTAGCGTGTGG - Intergenic
1122447549 14:101781021-101781043 GAACCATGGAATGCAGCGTGGGG + Intronic
1122505540 14:102229522-102229544 CAAGCACGGACTGCAGCGTGGGG + Exonic
1125356193 15:38819395-38819417 GAAAGATGGAATGCAGCCAGGGG + Intergenic
1133146632 16:3791863-3791885 GAGCCATGGAGTGCAGGGTGAGG - Intronic
1133759063 16:8783588-8783610 GAACCTTGGGATGCTGCCTGTGG - Exonic
1135258209 16:20958667-20958689 GAACCATGGAATACAGAGAAGGG - Intronic
1137723651 16:50642415-50642437 GGACCACAGAATGCAGCCTGGGG + Intergenic
1138033561 16:53580217-53580239 GTACCATGGACTGCAGCAGGAGG - Intergenic
1141675821 16:85516757-85516779 TAACCATGGGGTGCAGCTTGGGG + Intergenic
1142541724 17:664916-664938 GAACCAGGGAATGCAGGAGGAGG + Intronic
1142687238 17:1584511-1584533 GAGCCATGGAAAACAGCGTTTGG + Intronic
1142694898 17:1628274-1628296 CCAGCATGGAACGCAGCGTGAGG + Exonic
1144460519 17:15455039-15455061 TAACAATGGCATGCAACGTGAGG + Intronic
1150612457 17:66744871-66744893 GAACCAAGGAATGCAGGTGGTGG - Intronic
1152178024 17:78800581-78800603 GAACCATGGAAGCCACTGTGTGG - Intronic
1157546526 18:48550435-48550457 GCCCCAGGGAATGCAGGGTGTGG + Intronic
1159220695 18:65460079-65460101 GAAACATGGAATGCGGAGGGGGG - Intergenic
1159913371 18:74166985-74167007 GAACCATGGAAAGAAGAGAGGGG + Intergenic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1164728601 19:30483906-30483928 GAATGATGGAATACAGGGTGGGG - Intronic
1165403874 19:35618432-35618454 GAACCATGGACGGCAGGGTCTGG - Exonic
1166328109 19:42063435-42063457 GAACCCTGGACTGAAGGGTGAGG - Intronic
1168224982 19:54988234-54988256 GAATAATGGGATGCAGGGTGAGG + Intronic
925890685 2:8431631-8431653 GAGCCAAGGAATGCAGCCTCCGG + Intergenic
931012558 2:57934034-57934056 GAAACATGGAATGCAAAGTTTGG - Intronic
933899374 2:86838058-86838080 GAACCATGGAAATCACGGTGAGG - Intronic
933942950 2:87260380-87260402 GAATGATGAAATGCAGCATGAGG + Intergenic
934298600 2:91762971-91762993 GATCCATGGCATGCACCCTGAGG + Intergenic
935781188 2:106511170-106511192 GAACCATGGAAATCACGGTGAGG + Intergenic
936337263 2:111601182-111601204 GAATGATGAAATGCAGCATGAGG - Intergenic
936398728 2:112149941-112149963 GACCCAAGGAACTCAGCGTGGGG + Intronic
936474125 2:112824671-112824693 AAACCATGAAATGCAGCATGTGG - Intergenic
941190023 2:162369833-162369855 GCACCATGGAATGTTGAGTGAGG + Intronic
943194064 2:184719731-184719753 GAACCATGAAATCCAGGATGAGG - Intronic
1179051117 21:37889376-37889398 GCACCAAGGAATGCAGCATGGGG - Intronic
1184142388 22:42585433-42585455 GCCCCATGGGATGCAGCGTGGGG - Exonic
953233862 3:41088748-41088770 GAATAAAGGAATGCAGAGTGGGG + Intergenic
974487818 4:62526713-62526735 GAACCATGGAATCCAGTGACTGG + Intergenic
979048309 4:115897575-115897597 GAAGCATTGAATGCAGGGAGGGG - Intergenic
989549934 5:42722607-42722629 GAACCATGGAGTGAAGCCTCAGG + Intergenic
989578079 5:43007381-43007403 GAACCTAGGCAGGCAGCGTGGGG + Intergenic
990301882 5:54457411-54457433 TAGACATGGAATGCAGGGTGTGG + Intergenic
997234913 5:132267237-132267259 GAACCATGGGACCCAGCATGTGG + Intronic
998178115 5:139914460-139914482 GAACCCTGGAAAGCAGCGAGAGG - Intronic
999763640 5:154722069-154722091 GCTCCATGGAAGGCAGCCTGAGG - Intronic
1000332940 5:160220044-160220066 GAAAAATGAAATGCAGCTTGAGG + Intronic
1002108890 5:176894632-176894654 GGAGCATGAAATGCAGCGAGGGG + Intronic
1002799267 6:505596-505618 GCACCTGGGAATGCAGAGTGGGG - Intronic
1004372040 6:15061069-15061091 GAACCATGGATGGCTGGGTGTGG - Intergenic
1009715811 6:67393993-67394015 GAACAATGAAATGCAGGTTGAGG + Intergenic
1009716941 6:67409901-67409923 GACCCAGGGAAGGCAGCATGAGG - Intergenic
1010754469 6:79651452-79651474 GAACCATGGAATGAAAGATGAGG - Intronic
1018202763 6:161410664-161410686 GAAACATGGAATGGAGGATGGGG + Intronic
1020617026 7:10471858-10471880 TAGCAGTGGAATGCAGCGTGTGG + Intergenic
1028897341 7:96056987-96057009 GAACCATGAAATGCAGGTGGAGG - Intronic
1030520609 7:110593647-110593669 GACACATGGAATGCAATGTGAGG - Intergenic
1033229409 7:139584573-139584595 GTCCAATGGGATGCAGCGTGAGG + Intronic
1034408164 7:150920226-150920248 GAACCATGCAAAGCTGTGTGAGG - Intergenic
1034882703 7:154774792-154774814 GAACCATGGAGTTCACAGTGTGG + Intronic
1036289573 8:7475542-7475564 GAAGAATGGCATGGAGCGTGGGG + Intergenic
1036331902 8:7835989-7836011 GAAGAATGGCATGGAGCGTGGGG - Intergenic
1037898797 8:22675658-22675680 GAACCAAGGGATGCATAGTGTGG + Intergenic
1044309669 8:90679265-90679287 GAGGCCTGGAATGCAGCATGGGG + Intronic
1059161996 9:112043299-112043321 GATCCATGGAGTGCAGGGTCTGG - Intronic
1186769926 X:12807607-12807629 GAACTACTGAATGCAGAGTGTGG + Intronic
1187118965 X:16384679-16384701 GCAACATGGAATGCAGCTGGAGG - Intergenic
1190998806 X:55637602-55637624 GCACCATGGACTGCAGTGGGAGG + Intergenic
1191196016 X:57723815-57723837 AAACCATGGGAAGCAGCATGAGG - Intergenic
1193046585 X:77060706-77060728 GAACCATGCACTGCAGGGAGGGG + Intergenic
1195213207 X:102670157-102670179 GAACAAAGAAATGCAGGGTGGGG - Intergenic