ID: 1122449074

View in Genome Browser
Species Human (GRCh38)
Location 14:101789328-101789350
Sequence TCTGGTAAGCAGCCTTTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122449071_1122449074 7 Left 1122449071 14:101789298-101789320 CCTAAGTTGATGGGAAAGTGGCT 0: 1
1: 0
2: 1
3: 13
4: 150
Right 1122449074 14:101789328-101789350 TCTGGTAAGCAGCCTTTGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122449074 Original CRISPR TCTGGTAAGCAGCCTTTGCA AGG Intronic
900877466 1:5353858-5353880 TCTGGTAAGCAGCATATGGGTGG + Intergenic
903006790 1:20303879-20303901 ACTGGGAAGCAGCCTGAGCAGGG + Intronic
906599378 1:47111257-47111279 TCTGGGAGGCAGAGTTTGCAGGG - Intronic
906805915 1:48778311-48778333 TCTGGTACACTGACTTTGCAAGG - Intronic
909627356 1:77732683-77732705 CCTTGTAAGCAGCCTTGGGATGG - Intronic
909700716 1:78519448-78519470 TCTGGTAAGCATCCAGTGAAAGG + Intronic
911847305 1:102770610-102770632 TCAGCTAAACAGCTTTTGCATGG + Intergenic
912594590 1:110861380-110861402 TCTGGTTAGGAGCCATTGCTGGG - Intergenic
916638635 1:166701866-166701888 ACTGGCAAGCTGTCTTTGCATGG - Intergenic
917801798 1:178578296-178578318 GCTGGGAAGCAGCCCTTGCCTGG - Intergenic
917908732 1:179617309-179617331 TCTGGCAAGCAGCGCTTACATGG - Intronic
918133292 1:181647201-181647223 TCTGGGCAGCATTCTTTGCAGGG + Intronic
922348128 1:224714164-224714186 TCTTTTAAGCAGCCTCTACAAGG + Intronic
923251055 1:232180105-232180127 TCTGGCCAGCAGCCTTTCCCTGG - Intergenic
1062922231 10:1289088-1289110 TCTGGGTAGCAGGCTTTGGAGGG - Intronic
1064388339 10:14919679-14919701 CCTGGAAAGCAGTGTTTGCAGGG + Intronic
1067545033 10:47186854-47186876 GCAGTTATGCAGCCTTTGCATGG + Intergenic
1068045395 10:51879958-51879980 TCTAGCAAGCATCCTTTACATGG + Intronic
1069722079 10:70556140-70556162 CCTAGTAAGCAGCCTTTGCTTGG - Intronic
1072257165 10:93631290-93631312 TCAGGCCAGCAGCCATTGCACGG - Intronic
1072552142 10:96487219-96487241 TCTGTTAAGCAGCCAGTGCCAGG + Intronic
1077287693 11:1775092-1775114 TCTGGTCTGCAGGCTTTGGAGGG + Intergenic
1077604524 11:3599686-3599708 TCTGCTGAGCAGCCTCCGCAGGG + Intergenic
1077868100 11:6239676-6239698 TCGGGGAAGCAGGCTCTGCAGGG - Exonic
1080265110 11:30392338-30392360 TGGGGTAAGCAGCCTGTTCAGGG - Intronic
1084101186 11:66950778-66950800 TCTGCTAAGCAGCCTTCTCTAGG + Intronic
1084384677 11:68835757-68835779 TCTGGGAAGCAGCCTGGGAAAGG + Intronic
1084443199 11:69187757-69187779 TCTGGCCAGCAGCCCTTGCCAGG + Intergenic
1084808214 11:71594355-71594377 TCTGCTGAGCAGCCTCCGCAGGG - Intronic
1084812357 11:71620968-71620990 TCTGCTGAGCAGCCTCCGCAGGG - Intergenic
1087080368 11:94165083-94165105 TCTGGTCAGCAGCGTTTGGTTGG + Intronic
1087920725 11:103863445-103863467 TCTAGTAAGCAGCCTCTAAATGG + Intergenic
1088136916 11:106567066-106567088 TCTGGCAAGCAAGCTATGCAAGG - Intergenic
1090562971 11:127952961-127952983 TCTGGAAAACAACATTTGCATGG + Intergenic
1090897831 11:130994741-130994763 GCAGGTAAGCATCCTTTTCATGG + Intergenic
1091495081 12:965501-965523 TTTGGTAGGCAGCATTAGCAGGG - Intronic
1093263616 12:16972803-16972825 TTTAGGAAGCAGCCTTTGTAGGG + Intergenic
1095987584 12:48009938-48009960 TGTGCCAAGCAGGCTTTGCAGGG - Intergenic
1099925597 12:89012597-89012619 CCTGGTAACCATCATTTGCAAGG + Intergenic
1100256616 12:92889251-92889273 TTTGGTAAGCAACCTTCACATGG - Intronic
1100394423 12:94172083-94172105 TCTGGTGACAAGCCTTGGCAAGG - Intronic
1102029251 12:109730561-109730583 TCTGGGAAGCAGCCTGTCCTCGG + Intronic
1106476345 13:30101662-30101684 TCCGGGAGGCAGCCTTTGCAGGG + Intergenic
1107261005 13:38491076-38491098 TCTGGGAAGCAGCTTTACCAAGG + Intergenic
1109301214 13:60592072-60592094 CCTGGAAAACAGCATTTGCAAGG - Intergenic
1109481446 13:62960969-62960991 CCTGGTAAGCAGCCTGAGCTCGG + Intergenic
1118531648 14:66713134-66713156 GCTGGTAAAGAGCTTTTGCATGG - Intronic
1118616328 14:67576709-67576731 TCTGGGAAGCAGGCTTTCCAGGG + Intronic
1122122904 14:99563959-99563981 TCAAGTAAGCAGCCTGGGCACGG + Intronic
1122449074 14:101789328-101789350 TCTGGTAAGCAGCCTTTGCAAGG + Intronic
1123756198 15:23399394-23399416 TGTGGTAAGAAACCTTGGCACGG + Intergenic
1124151330 15:27181150-27181172 TGTGGCAAGCAGACTTTACACGG + Intronic
1126419690 15:48458156-48458178 TATAGTCAGGAGCCTTTGCAAGG + Intronic
1128366165 15:67004895-67004917 TGTGATAACCAGCCTTGGCAAGG + Intergenic
1128716597 15:69913257-69913279 GCAGATAAGCAGCCCTTGCATGG - Intergenic
1130271709 15:82454341-82454363 ACTGGTAGGCAGCCTTTAAATGG - Intergenic
1130464058 15:84181728-84181750 ACTGGTAGGCAGCCTTTAAATGG - Intronic
1130500209 15:84491813-84491835 ACTGGTAGGCAGCCTTTAAATGG + Intergenic
1132546150 16:534323-534345 GCTGGTGAGGAGCCTGTGCACGG + Intronic
1133953310 16:10417311-10417333 TCTGGTAAGCAGCATATACGTGG - Intronic
1134670536 16:16051685-16051707 TCACATAAGCAGCCTTTGCTTGG + Intronic
1134794653 16:17023900-17023922 TCTGGCAGGTAGCATTTGCAAGG + Intergenic
1138702586 16:58879546-58879568 TCTGGAAATTAGCCTTGGCAAGG - Intergenic
1139916467 16:70431304-70431326 GCAGGTCAGCAGCCTTTGGAGGG - Intronic
1142425579 16:90000634-90000656 TGTGGAGAGCAGCCTGTGCAGGG + Intergenic
1142646119 17:1314996-1315018 TCTAGTAAGTGGCCTTTGCATGG + Intergenic
1144785908 17:17831445-17831467 TCTGGGAAGCAGCCTCTGACGGG + Intronic
1146574949 17:33982709-33982731 TCTGGGAAGCATGCTTTGAAAGG + Intronic
1148926384 17:51089749-51089771 TCTGGTAGGCAGAGGTTGCAGGG - Intronic
1149845063 17:60004172-60004194 TCTAGAAAGCAACATTTGCAAGG - Intergenic
1149890130 17:60381673-60381695 TCTAGAAAGCAACATTTGCAAGG - Intronic
1150659032 17:67059558-67059580 TCTGGCAAGCAGCATTTGGCGGG - Intergenic
1152470381 17:80487802-80487824 TGAGGAAAGCAGCCTGTGCAAGG + Intergenic
1152595094 17:81234038-81234060 TCTGTTCTGCAGCTTTTGCAGGG - Exonic
1154134042 18:11760684-11760706 GCTGGTAAGGAGCCCCTGCAGGG + Intronic
1154532262 18:15359152-15359174 TTTGGAAAGTAGCCTTTGGACGG - Intergenic
1155926325 18:31659456-31659478 TCTGCTTAGCAGCCGTGGCAGGG - Intronic
1164536213 19:29088101-29088123 TCTGTTTGGCAGCCTTTGGAAGG + Intergenic
928207304 2:29295182-29295204 TCTGGTAAACAGCCTTTAACAGG + Intronic
928717369 2:34076853-34076875 TCTGGTAAACAGCCCTTGAGGGG - Intergenic
928812219 2:35242101-35242123 TCTGGTAAGCAGCTTGTGGTTGG - Intergenic
931429878 2:62199941-62199963 ACTGGTAAGGAGACTTTGCCAGG + Intronic
936619760 2:114083113-114083135 TCAAGTAAGGAGCCATTGCAGGG - Intergenic
937090178 2:119201041-119201063 TCTGGGAAGCTGCCTCTGCTTGG + Intergenic
937498580 2:122451608-122451630 TCTGGTTAGGAGCCATTGCTTGG - Intergenic
940873028 2:158875603-158875625 TCTGCTACTCAGCCTCTGCAGGG - Intergenic
942563050 2:177240409-177240431 ACTGGCCAGGAGCCTTTGCATGG + Intronic
942727966 2:179030916-179030938 TTTGGTAAGCAGGCTTTTCCTGG + Intronic
947967738 2:234296265-234296287 TCTGATGAGCAGCCTTTGCCTGG + Intergenic
1168967996 20:1911652-1911674 TCTGTTCACCAGCCTTTGCTGGG - Intronic
1171135351 20:22690198-22690220 CCTGGAAAACAGCGTTTGCAGGG + Intergenic
1176765100 21:13009048-13009070 TTTGGAAAGTAGCCTTTGGATGG + Intergenic
1178687233 21:34721350-34721372 CCTGGAAAGAGGCCTTTGCAGGG - Intergenic
1179843584 21:44093961-44093983 TCTGCTCAGCACCCTTCGCATGG + Intronic
1180031241 21:45209871-45209893 TCTGCTCAGCAGCATTTTCAGGG - Intronic
1184838573 22:47038837-47038859 TCTGGCCAGCAGCATTTGCTGGG + Intronic
949503366 3:4703443-4703465 TCTCATAGGCAGCCTTTGAAAGG + Intronic
951916084 3:27802336-27802358 TCTGGTAAACAGTCTTGGCAGGG - Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
954396321 3:50295269-50295291 TCTGGTAGGCAGCCAGTGCCAGG + Exonic
954510957 3:51124493-51124515 TCTGGTAAGCTGATTGTGCAGGG + Intronic
954853153 3:53620170-53620192 TCTAGTGAGCGGCCTTTCCATGG + Intronic
956087555 3:65628540-65628562 TCATGTAAGCAGCCTTTGCCTGG + Intronic
966413518 3:179666668-179666690 TCAAGTAAGCAGCCTGTGCCAGG - Intronic
967692260 3:192489581-192489603 CTTGGGAAGAAGCCTTTGCAGGG + Intronic
969023655 4:4156521-4156543 TCTGCTGAGCAGCCTCCGCAGGG + Intergenic
969735020 4:8982349-8982371 TCTGCTGAGCAGCCTCCGCAGGG - Intergenic
969789761 4:9484663-9484685 TCTGCTGAGCAGCCTCCGCAGGG - Intergenic
974300796 4:60064837-60064859 TCTGGTGAGGAGCCTCTTCAGGG + Intergenic
975654962 4:76632362-76632384 TCTTTTAAGTAGCCTTTGCTGGG - Intronic
981834896 4:149043168-149043190 ACTGGTATGCAGCCTTTGACTGG + Intergenic
981953692 4:150443950-150443972 ACTGGTACGCTGCCTCTGCAAGG + Intronic
983903866 4:173165372-173165394 GCTGGGAGGCAGCCTTTGTAGGG - Intergenic
984748337 4:183245757-183245779 CGTTGTAAGCAGCCTTTGGATGG + Intronic
984831583 4:183980476-183980498 TCGGGAAAGCAGCCCTTGGAAGG + Intronic
985715965 5:1461702-1461724 TCTGATAAACAGACTTTGAATGG - Exonic
986347824 5:6850919-6850941 TCTGAGAAGCAGCGTTTTCAAGG + Intergenic
986540087 5:8835932-8835954 TCTGCTCATCAACCTTTGCAAGG + Intergenic
989121125 5:38005437-38005459 CCTGGAAATCAGCCTTTTCAGGG + Intergenic
989548079 5:42697727-42697749 TGAGGTAGGCAGCCTTTGGAGGG + Intronic
993566929 5:89488085-89488107 TCTAATAAGCAGCTTTTGCTGGG + Intergenic
995329771 5:110933846-110933868 TCTGGGATGAAGCCTCTGCAGGG - Intergenic
996510504 5:124310575-124310597 TATGGTTAGCAGCCTGTTCAAGG - Intergenic
997877738 5:137564413-137564435 ACTGCTAAGAAGCCTTTGTATGG - Intronic
999626716 5:153528920-153528942 TCTGGTAACCAACCTATGCAAGG - Intronic
999798432 5:155009697-155009719 TGTGGCAAGCAGCAGTTGCAAGG - Intergenic
1001537263 5:172507007-172507029 TTTGGTAGCCAGCCATTGCAGGG - Intergenic
1003871641 6:10408692-10408714 TATGTTTAGCAGCCCTTGCATGG - Intronic
1007593559 6:43037948-43037970 TTTGGTCAGCAGCCTTGGTAAGG - Exonic
1007703157 6:43775953-43775975 TCTGGAAAGCAGACCTTGGAGGG + Intronic
1008307292 6:49918802-49918824 TCTGGTACCCAGTCTTTGGATGG - Intergenic
1008344165 6:50405661-50405683 TCTGGTAACCATCCTATGAACGG + Intergenic
1008489609 6:52072496-52072518 TCTGGGATACAGCCTTTGAAAGG - Intronic
1008534712 6:52499050-52499072 ACTGGTCTTCAGCCTTTGCAAGG + Exonic
1008876886 6:56338929-56338951 TCTGCTAAGCAGTCTTTTTAGGG - Intronic
1014764727 6:125393301-125393323 TCTTTTAAGGAGCCTCTGCAAGG - Intergenic
1017709093 6:157150203-157150225 TTTGGCACGCAGCCTTTGGAGGG + Intronic
1018276865 6:162142054-162142076 TCTTTTAAGCAGCTTATGCATGG - Intronic
1020310762 7:6866698-6866720 TCTGCTGAGCAGCCTCCGCAGGG + Intergenic
1020855775 7:13420838-13420860 TCTGGTATGCAGCCACTGAAAGG - Intergenic
1022301412 7:29105999-29106021 TCTGGACAGCAGCCTTGGGAAGG - Intronic
1022573689 7:31477409-31477431 TCTGGGAGGCACACTTTGCAGGG - Intergenic
1025140530 7:56459786-56459808 TCTGGGAAGCAGAAGTTGCAGGG + Intergenic
1031421887 7:121563334-121563356 TTTGGAAAGCAGCCTTTGGCTGG - Intergenic
1031882923 7:127217325-127217347 TTTGGTAAGCTGCCTTTTCAAGG - Intronic
1032997236 7:137461145-137461167 TCTGGTACGCTGACTTTGTATGG + Intronic
1035929986 8:3769945-3769967 TTTGGGAAGAAGCCTTTGAAAGG + Intronic
1038647387 8:29373003-29373025 TCTGGGAAGCACCCTTAGCAAGG - Intergenic
1039557571 8:38487649-38487671 GCAGGTAAGCAGCCTCTGCCTGG + Intergenic
1039838446 8:41276449-41276471 TCTGTTAAGCTGCCATTGCAAGG - Intronic
1043384818 8:79737848-79737870 TCAGGTCAGCACCCTGTGCAAGG + Intergenic
1045874877 8:106968726-106968748 TCTGCTAAGAAGCATTTACAAGG - Intergenic
1046566767 8:115911814-115911836 TCTGGTCAACAGCCATTGCTGGG - Intergenic
1049362074 8:142216595-142216617 ACTGGTCAGCAGCCTGGGCACGG + Intronic
1050416006 9:5418549-5418571 GCTGGACAGCAGCCTCTGCAAGG - Intronic
1050691733 9:8234712-8234734 TCTGGGAAGGAACCTCTGCAGGG + Intergenic
1052290451 9:26834129-26834151 TTTTGTGAGGAGCCTTTGCATGG - Intergenic
1052819211 9:33125630-33125652 ACTTGCAAGCAGCCTTTGTAGGG + Intronic
1052994757 9:34545922-34545944 TCTGGGAAAAAGCCTTTGTAAGG - Intergenic
1057906195 9:98985557-98985579 CCTGGGAAGCAGTCTCTGCAGGG - Exonic
1060785578 9:126449488-126449510 TCTGGAAATGAGCCTTAGCAAGG - Intronic
1061987663 9:134139262-134139284 TCGGGCCAGCAGCCTGTGCATGG + Intronic
1185576280 X:1175272-1175294 TGTGTTCTGCAGCCTTTGCAGGG - Intergenic
1186950294 X:14617054-14617076 TGTTGTTGGCAGCCTTTGCAGGG + Intronic
1187780568 X:22818089-22818111 TCTGGTGGGAAGCCTTAGCATGG - Intergenic
1187827066 X:23342363-23342385 TGTGGCAAGCAACCTTAGCATGG + Intronic
1189289997 X:39878184-39878206 CCTGCTAAGCAGCCTATCCAGGG + Intergenic
1190118644 X:47642424-47642446 TGGAGTGAGCAGCCTTTGCAAGG - Intronic
1190821975 X:53982030-53982052 CTTGGTAAGCTGCCTTTCCATGG + Intronic
1195050796 X:101094870-101094892 TCTGAGAAGAAGCCTTTGCCAGG + Exonic
1195823201 X:108969723-108969745 TCTGTTATGCAGCCATTGCCAGG - Intergenic
1196502308 X:116399668-116399690 TCTGGTGAGCAGCCTGTTTAAGG + Intergenic
1199719573 X:150532847-150532869 TCTGTGAACCAGGCTTTGCACGG + Intergenic
1199799543 X:151235936-151235958 TTTGGTCAGCAGACTTTACAAGG + Intergenic