ID: 1122449843

View in Genome Browser
Species Human (GRCh38)
Location 14:101796839-101796861
Sequence CTTGAGGAGCAGAGGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 1, 1: 0, 2: 3, 3: 73, 4: 558}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122449843_1122449847 -3 Left 1122449843 14:101796839-101796861 CCCTGCTGCCTCTGCTCCTCAAG 0: 1
1: 0
2: 3
3: 73
4: 558
Right 1122449847 14:101796859-101796881 AAGTGTTTCCTGAACTGCCCTGG 0: 1
1: 0
2: 2
3: 14
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122449843 Original CRISPR CTTGAGGAGCAGAGGCAGCA GGG (reversed) Intronic
900029362 1:359557-359579 CTTGGGTGGCAGAGGCAGCCTGG + Intergenic
900049962 1:588329-588351 CTTGGGTGGCAGAGGCAGCCTGG + Intergenic
900110393 1:1003040-1003062 CTTGCTGAGCAGAGGCAGGAGGG + Intergenic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
900781075 1:4617546-4617568 CTTGAGGAGCAGGAGCAGCCAGG + Intergenic
902530260 1:17086297-17086319 CGTGGGGAGCAGAAGCAGCAAGG + Intronic
902932207 1:19739670-19739692 CTTGAACTGGAGAGGCAGCAAGG + Intronic
902974480 1:20079000-20079022 CTCGAGAGGCAGAGGCAGGAGGG + Intronic
903446634 1:23426414-23426436 CTTGGGTCGCAGAGGCAGCTTGG + Intergenic
903674327 1:25054750-25054772 CATGGGGAGCAGGGGGAGCAGGG + Intergenic
904187099 1:28714087-28714109 TTGGAGGAGCAGAAGAAGCAAGG + Exonic
904277271 1:29392644-29392666 CATGAAGGGCAGAGGAAGCAAGG - Intergenic
904583913 1:31568533-31568555 CTAGGGCAGCAGAGGAAGCAAGG - Intergenic
904773281 1:32893001-32893023 CTGGAGGGCCAGAGGCAGCTGGG - Intronic
905170434 1:36106690-36106712 TTCGAGGAGCTCAGGCAGCAGGG + Intronic
905811843 1:40918848-40918870 CTAGAGGAGCAGCAGCAGCTTGG - Intergenic
906277854 1:44531177-44531199 CTTGAGGATTACAGGAAGCAAGG - Intronic
906314592 1:44778096-44778118 CTGGAGGAGCAGTTCCAGCAGGG + Exonic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
906834055 1:49063843-49063865 CTGGAGGAACAGAAGCAACAGGG - Intronic
907074987 1:51570039-51570061 CTTGAAAATCAGAGGTAGCATGG - Intergenic
907223582 1:52924999-52925021 CTTGAGGAGCTGAGGCAGAAAGG - Intronic
910258126 1:85269717-85269739 AGTGAGGAACAGAGGCAGGAGGG + Intronic
911885764 1:103297078-103297100 CTTAAGGATCAGAGGAATCAGGG + Intergenic
912282804 1:108334505-108334527 CTTGAGGAAGAAAGGCAGGATGG + Intergenic
912507314 1:110165233-110165255 CTTGTGTAGCACAGGCAACACGG + Intronic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
913105382 1:115609544-115609566 CTTGAGAGGCTGAGGCAGGAAGG - Intergenic
913500833 1:119471269-119471291 CCTGAGGAGGAGATGGAGCAAGG + Intergenic
913557071 1:119978209-119978231 CTTGAGTTGAAGAGACAGCATGG + Intronic
913714402 1:121519388-121519410 CTGGAGGAGGAGAAGCAGCCGGG - Intergenic
914264100 1:146022802-146022824 CTTTGGGAGCTGAGGCAGGAGGG + Intergenic
915033644 1:152905004-152905026 CAAGAGGAGCAGAGGCATAAAGG - Intergenic
915049265 1:153050092-153050114 TGCCAGGAGCAGAGGCAGCATGG - Intergenic
916870064 1:168904047-168904069 CTAGAGGAGAAGAGGCAGAAAGG - Intergenic
917552101 1:176042780-176042802 TTTGAGAGGCCGAGGCAGCAAGG + Intronic
920195480 1:204223532-204223554 CTGGAGGAGCCGGGGAAGCAGGG + Exonic
920379467 1:205527369-205527391 CTTGAGAGGCTGAGGCAGGAGGG + Intronic
920385273 1:205567161-205567183 CTAGAGGAGCTGAGCCAGCAAGG + Intergenic
921813773 1:219544169-219544191 CTGGGTGAGCACAGGCAGCAGGG + Intergenic
922114160 1:222593916-222593938 CTTGAGAAGCGGAGGTTGCAGGG + Intergenic
922755648 1:228095408-228095430 CTAGGGGAGCAGCTGCAGCAGGG - Intronic
923665273 1:235993448-235993470 GGTGAGGAGGAGAGGAAGCACGG + Intronic
923669587 1:236029067-236029089 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
923765508 1:236889356-236889378 CTTGAATATCAGAGGCAGAAAGG - Intronic
924246852 1:242093635-242093657 CTTTAGGATCAGAGGCAACATGG - Intronic
924255724 1:242180873-242180895 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
924583677 1:245343410-245343432 CTGGCAGAGCAGAGGCAGAATGG - Intronic
1062798059 10:358847-358869 GGGGAGGAGCAGAGGAAGCAGGG + Intronic
1063159296 10:3408199-3408221 CCTCAGGAGCAGAGGATGCAGGG + Intergenic
1063468263 10:6262772-6262794 CTAGAGGAGCAAAGGCAAGAGGG + Intergenic
1063713781 10:8507083-8507105 GATGAGGGGCAGAGGCTGCAAGG + Intergenic
1063832048 10:9964440-9964462 CTTGAGCAGAAGCAGCAGCATGG - Intergenic
1063959755 10:11297440-11297462 CTTGTGGAACAGAGGGACCAGGG + Intronic
1065217535 10:23463789-23463811 CTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1065628433 10:27654059-27654081 CTTGAGAGGCAGAGGCAGGGGGG + Intergenic
1065668459 10:28087729-28087751 GCTGAGGAGAAGAGGCAACAGGG + Intronic
1065954722 10:30683697-30683719 AGTGAGGAGGAGAGGCATCAGGG + Intergenic
1070210151 10:74309612-74309634 TTTGGAGAGCAGAGGTAGCAGGG + Intronic
1070750035 10:78958581-78958603 CTTGGAGAGCAGAGAGAGCAGGG + Intergenic
1071306401 10:84302826-84302848 CTGGGGGAGAGGAGGCAGCATGG - Intergenic
1071706976 10:88009735-88009757 CTTGGGAAGCTGAGGCAGAAGGG - Intergenic
1072374402 10:94800066-94800088 CTTGAGGAGGAGAGGCACTCTGG + Intronic
1072574188 10:96685362-96685384 TGGGAGGAGCAGAGGCAGCCAGG + Intronic
1072669911 10:97421749-97421771 CTTGGGAGGCAGAGGCAGAATGG + Intronic
1072798349 10:98374068-98374090 CTTCAGGGGCTGAGGGAGCATGG - Intergenic
1072953914 10:99872339-99872361 GTTCAGGAACAGAGGCAGCCAGG + Intergenic
1073123474 10:101135549-101135571 CTAGGGGAGGAGAGGCAGCCTGG + Intronic
1073218007 10:101847358-101847380 CTTGGGCAGCAGGGGCAGGAGGG - Exonic
1073249641 10:102114023-102114045 CAGCAGGAGTAGAGGCAGCAAGG + Intronic
1073423462 10:103442169-103442191 CTTGAGGAGCAGATGACTCACGG + Intronic
1073514688 10:104065863-104065885 CTTCAGGAGAAAAGGCAACAAGG - Intronic
1073632016 10:105158663-105158685 GTTGGGGGGCAGAGGCAGGAGGG + Intronic
1074164421 10:110862410-110862432 CTTAAAAAGCAGAGGCCGCAGGG - Intergenic
1074214285 10:111369206-111369228 CTTGAGGTGCAGAATCACCAAGG - Intergenic
1074411658 10:113234034-113234056 CACCAGGAGCAGAGGCAGCCAGG - Intergenic
1074969993 10:118528286-118528308 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1075303023 10:121342267-121342289 CTAGAGGGGAAGAGGCAGGAAGG + Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075894540 10:125983681-125983703 ATTGAGGAACAGAGGGAACAAGG + Intronic
1076020095 10:127065530-127065552 CTTCTGGAGCACTGGCAGCAGGG - Intronic
1076607644 10:131700010-131700032 TTTGAGCTGCAGAGGGAGCATGG - Intergenic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077234502 11:1473353-1473375 CTCGAGGAGCAGATGCTGAAAGG - Intronic
1077329613 11:1978277-1978299 CTTGAGGTGCAGAGAGAGGATGG + Intronic
1077995498 11:7449030-7449052 GTGGAGGAGCAAAGGCATCAAGG + Intronic
1078313062 11:10265795-10265817 CTTGAGAGGCTGAGGCAGGAGGG - Intronic
1078530167 11:12130956-12130978 CTGGAGGAGCAGAGGCCGGAGGG + Intronic
1078581122 11:12540422-12540444 TGTGAGGAGCAGAGGAAGCATGG - Intergenic
1080080615 11:28214148-28214170 CTTGAGAGGCTGAGGCAGAAGGG - Intronic
1080109326 11:28547757-28547779 CCTCAGGAACAAAGGCAGCAGGG - Intergenic
1080641254 11:34159789-34159811 TCTGAGGGGCAGAGGCTGCAGGG + Intronic
1080878939 11:36301352-36301374 CTTGAGCATCAGAGGCGTCAAGG + Intronic
1081547282 11:44080369-44080391 CTTGAGGAGTTGATGGAGCATGG + Intronic
1081724809 11:45320869-45320891 CTGGAGAAGCTGAGGCAGCATGG + Intergenic
1081866926 11:46365292-46365314 CATCAGGAGCAGAGTCAGAAGGG + Intronic
1082681971 11:56185132-56185154 CTAGAGGAGAAGAGAGAGCAAGG - Intergenic
1082740064 11:56900964-56900986 CCTGTGAAGCAGAGGGAGCAAGG + Intergenic
1082794417 11:57369338-57369360 CTGGAGGAGGAGAGGCAGGGCGG - Intronic
1083668181 11:64286329-64286351 CTTGGGGAACACAGGCAGCCTGG - Intronic
1083714939 11:64569738-64569760 ATAGAGGAGAGGAGGCAGCAGGG - Exonic
1084147331 11:67272078-67272100 CATGAGGGGCACAGGAAGCATGG + Intronic
1084200400 11:67553454-67553476 CTTGGGCAACAGAGGCAGCTTGG + Intergenic
1084269902 11:68023166-68023188 CTTAAGCTGCAGAGGCAGCCTGG + Intronic
1084410431 11:69003400-69003422 GCTGAGGAGCAGGGGCAGGAGGG + Intergenic
1085034488 11:73291940-73291962 TTGGAGCAGCTGAGGCAGCAAGG - Intronic
1085071193 11:73547552-73547574 CTTGGGATGCAGAGGCAGGAGGG + Intronic
1085410714 11:76288790-76288812 CGGGAGGAGCAGAGGAAGTAAGG + Intergenic
1085440233 11:76555010-76555032 CATGAGCAGCAAGGGCAGCATGG + Intergenic
1085602049 11:77863755-77863777 TTTGAGGGGCTGAGGCAGGAGGG - Intronic
1085607376 11:77914153-77914175 ATTCAGGAGCATAGGCAGGATGG - Intronic
1085656284 11:78318220-78318242 CTGGTGGAACAGAGGCAGAAGGG + Intronic
1086904720 11:92405272-92405294 CTAGAGGATCACAGGCATCATGG + Intronic
1087017838 11:93571879-93571901 GCTGGAGAGCAGAGGCAGCATGG + Intergenic
1088644312 11:111904543-111904565 CTTGGGAAGCTGAGGCAGGAAGG + Intergenic
1088723731 11:112616804-112616826 CCTGAGGAATAGAAGCAGCATGG + Intergenic
1088823198 11:113474221-113474243 CTTGAAGAGCAGAGGTAAGAGGG - Intronic
1089094353 11:115906478-115906500 CATGAGGAGCAGAGACTGAAGGG - Intergenic
1089605970 11:119641518-119641540 CCTGAGGATGAGAGGAAGCAGGG - Intronic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1089804998 11:121078739-121078761 CTAGAGCAGCAGAAGCAGTAAGG - Intronic
1090188353 11:124752370-124752392 CTTGGGGAGAAGAGGAAGGAAGG - Intergenic
1090930928 11:131297523-131297545 CATGAGGAGGAGAGGCAGCCTGG - Intergenic
1091198293 11:133750378-133750400 ATTGAAGACCAGAGGCAGGAAGG + Intergenic
1202812592 11_KI270721v1_random:33456-33478 CTTGAGGTGCAGAGAGAGGATGG + Intergenic
1091796585 12:3300788-3300810 ATGGAGGAGCAGAGACTGCATGG + Intergenic
1092387182 12:8044776-8044798 ATGGTGGAGCAGTGGCAGCAGGG + Exonic
1093458961 12:19391279-19391301 CTTGAGGATTGGAGGCAGAAGGG + Intergenic
1095927219 12:47591209-47591231 CCTGAGGCTCAGAGGCATCAGGG - Intergenic
1096181530 12:49553768-49553790 CTTGTAGAGCAGAGGCAGCTAGG + Intronic
1096240571 12:49957781-49957803 CTAGAGGTTCAAAGGCAGCAAGG + Exonic
1096773848 12:53952430-53952452 CGTGAGGAGCAGCGGCCACAGGG - Intergenic
1097357743 12:58621041-58621063 CTAGAGGAACAGAGGCTGGAAGG - Intronic
1097392751 12:59035470-59035492 GTAGAGGAACAGGGGCAGCAAGG + Intergenic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1097679778 12:62637857-62637879 TTTGAGGGGCAGAGCCAGCACGG - Intergenic
1097968912 12:65611227-65611249 CTTGAGGATCAAAGGCACCATGG + Intergenic
1098541614 12:71663730-71663752 GTTGGGGAGCAGAGGCCGCTTGG - Exonic
1100359252 12:93861152-93861174 CTGAGGGAGCAGAGGCTGCAGGG + Intronic
1100728534 12:97437114-97437136 GGTGAGGAGCAGAGACAGGAGGG - Intergenic
1100870872 12:98908651-98908673 CTTGAGGAGAAGAGTCACCATGG + Intronic
1101763318 12:107676959-107676981 CATGAGAAGCAGAGGAAGGATGG - Intergenic
1101821810 12:108190412-108190434 CTTGGGGGGCAGAGGCAGTTCGG - Intronic
1102081934 12:110105331-110105353 CTTTAGGATCAGAGACAACAGGG + Intergenic
1102596647 12:113998043-113998065 CTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1102755198 12:115334170-115334192 CTGGAGAAGGAGAGGAAGCAAGG + Intergenic
1102797953 12:115705613-115705635 CTGGAGGAGAAGAGGCCTCATGG + Intergenic
1102957007 12:117065291-117065313 CTGGGGGAGCAGAGGAAGAAGGG + Intronic
1102966935 12:117135151-117135173 ATTCAGGAGCAGAGGCAGGAGGG - Intergenic
1103519797 12:121530738-121530760 CTTGAGAAGCCCTGGCAGCAGGG - Intronic
1103610410 12:122120724-122120746 CTTCAGGAGCAGGGGAAGGAGGG + Intronic
1103705892 12:122872134-122872156 GGTGGGGAGCAGAGGCAGCATGG - Intronic
1103955445 12:124573961-124573983 CTGAAGGAGCAGAGGAAGCCGGG - Intergenic
1104745971 12:131210798-131210820 TGTGAAGAGCAGAGGCAGGAGGG + Intergenic
1105035900 12:132920776-132920798 CTTGGGAAGCTGAGGCAGAAGGG - Intronic
1106755735 13:32821289-32821311 CTTGAGGACTAGAGGAAGCTGGG + Intergenic
1107371558 13:39755681-39755703 CTTGAGGATCTGAGCAAGCAGGG + Intronic
1107566543 13:41611042-41611064 CTAAATGAGCAGAGGCACCAGGG - Intronic
1107769482 13:43774923-43774945 CCTGTGGAGCAGAGGTTGCAGGG - Intronic
1108936693 13:55890918-55890940 TTTGAGGCTCAGAGGCAGAAGGG - Intergenic
1109301270 13:60592632-60592654 CTTGCGGAGAAGGGGCATCACGG + Intergenic
1110474915 13:75902466-75902488 CTTGAGGTACAGAGGTGGCAGGG - Intergenic
1111883235 13:93985327-93985349 CTTGAGAGGCTGAGGCAGGAAGG + Intronic
1113063330 13:106349077-106349099 GTTGAGAAGCAGGGGCAGCCAGG + Intergenic
1113949496 13:114064205-114064227 CTGCAGGAGCAGAGGCTGCGAGG + Intronic
1114476445 14:22998536-22998558 ATTGAGGAGCTGCGGCAGCTGGG - Exonic
1114792438 14:25674695-25674717 GTTGAAGAGCAGGGGCAACAGGG + Intergenic
1115127226 14:30010512-30010534 CTTGGGGAGCAGGGGCAGGAGGG + Intronic
1116996776 14:51332995-51333017 CATGAGCAGAGGAGGCAGCAGGG - Intergenic
1117119850 14:52554580-52554602 CTTGAGGAGGGGAGGAAGCAAGG + Intronic
1117530105 14:56652388-56652410 CTTGAGAGGCTGAGGCAGGAGGG + Intronic
1118650550 14:67888466-67888488 CTTGAGTAGCTGAGACTGCAGGG - Intronic
1119152306 14:72372906-72372928 CTTGAGGCTAAGAGGCTGCATGG + Intronic
1119583562 14:75810607-75810629 TTTGAGGGGCTGAGGCAGGAGGG - Intronic
1119749711 14:77068467-77068489 CTTCGGGAGCAGTGGCAGGAGGG - Intergenic
1120979599 14:90278513-90278535 CTGGAGGAGCTCAGGAAGCAAGG + Intronic
1121125336 14:91403146-91403168 CGCCAGGTGCAGAGGCAGCAAGG - Intronic
1121936038 14:98019832-98019854 CTTGAGGAGAAGCAGCAGGATGG - Intergenic
1122082982 14:99279817-99279839 CTTAGGGATCAGAGGGAGCATGG - Intergenic
1122252430 14:100449357-100449379 CTTTGGGAGCAGAGACAGCCTGG + Intronic
1122319215 14:100843685-100843707 ATAGAGAGGCAGAGGCAGCAGGG + Intergenic
1122449843 14:101796839-101796861 CTTGAGGAGCAGAGGCAGCAGGG - Intronic
1122600979 14:102921832-102921854 CTTGGGGGGCTGAGGCAGAACGG - Intergenic
1122981525 14:105194322-105194344 CTTGAAGACCAGAGGCCCCAGGG - Intergenic
1123139178 14:106058698-106058720 AGTGAGGAGCAGAGGCAGCGAGG - Intergenic
1123944699 15:25233382-25233404 CTTGAGGTCCAGTGGCAGGAAGG + Intergenic
1123991946 15:25689822-25689844 CTTGAGGAGGAGAGCAGGCATGG + Intronic
1124216142 15:27808392-27808414 GTTGGGGAGCAGAGGCAGCAAGG + Intronic
1124608812 15:31193510-31193532 CTGGAAGGGCAGAGGCAGGAGGG + Intergenic
1125390431 15:39186618-39186640 CTCCAGGAGCAGAGGAAGAACGG - Intergenic
1125704370 15:41720125-41720147 CTTGAAGAACAGTGGCAGAATGG + Intronic
1125717957 15:41830417-41830439 CGTGAAGAGGAGAGGCAGCTGGG + Intronic
1126101111 15:45118804-45118826 CTTGAAGAGGCAAGGCAGCACGG + Intronic
1126392796 15:48177923-48177945 CCTGAGGAGCAGGTGCAGCTGGG - Intronic
1126990910 15:54374427-54374449 CTGGAGGGGCCAAGGCAGCAGGG + Intronic
1127054972 15:55121953-55121975 CTTGGGAAGCTGAGGCAGAATGG + Intergenic
1127271698 15:57407563-57407585 CTTGAGAGGCTGAGGCAGGAGGG + Intronic
1127332385 15:57951688-57951710 GTCAAGGAGCACAGGCAGCAAGG - Intergenic
1128448451 15:67785635-67785657 CTGGAGGTGTGGAGGCAGCAGGG + Intronic
1128725199 15:69982840-69982862 TCTGAGGAGCAGAGGCAGGGTGG + Intergenic
1128868826 15:71136804-71136826 CCTGAGGAGAAGGGGCAGGAAGG + Intronic
1129172319 15:73815792-73815814 CTGGAGGAGCAGGGGCAGAAAGG - Intergenic
1129915632 15:79267467-79267489 TTTGAGTAGCTGAGGCAGGAAGG + Intergenic
1129968538 15:79757813-79757835 CTGGGGGACCAGAGGCAGCACGG + Intergenic
1130305976 15:82712232-82712254 CTTCAGGAGCAGTGGCAAGATGG - Intergenic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131482716 15:92795561-92795583 TTTCAGGAGCAGGGGGAGCATGG + Intronic
1131668877 15:94598296-94598318 CCAGAGGATCAGAGGCTGCATGG + Intergenic
1132030986 15:98438398-98438420 GGCAAGGAGCAGAGGCAGCAGGG + Exonic
1132149332 15:99448179-99448201 CTAGAGAAGCAGAGGCAGGGAGG + Intergenic
1132252131 15:100341864-100341886 CAGGACGAGCGGAGGCAGCAGGG + Exonic
1132329824 15:101004499-101004521 GTTGAGCTGCAGAGGCAGCCAGG + Intronic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1132666761 16:1084535-1084557 CCTGTGGAGCAGAGACAGCCAGG + Intergenic
1132946551 16:2534746-2534768 CTTGTGGGCCAGAGGCAGCCAGG + Intergenic
1133318743 16:4900081-4900103 ACTAAGGAGCAGAGGAAGCATGG + Intronic
1133971939 16:10574495-10574517 CTGGAGGAGCAGTGGGTGCATGG - Intronic
1134523785 16:14929832-14929854 GTTGAGCTGCAGATGCAGCACGG - Intronic
1134549117 16:15131103-15131125 GTTGAGCTGCAGATGCAGCACGG + Intronic
1134689609 16:16182646-16182668 TTTGAGGAGCAGTGGGAGCTGGG + Intronic
1134711376 16:16328317-16328339 GTTGAGCTGCAGATGCAGCACGG - Intergenic
1134719226 16:16371620-16371642 GTTGAGCTGCAGATGCAGCACGG - Intergenic
1134948200 16:18340265-18340287 GTTGAGCTGCAGATGCAGCACGG + Intergenic
1134955453 16:18380376-18380398 GTTGAGCTGCAGATGCAGCACGG + Intergenic
1135529388 16:23239665-23239687 CTTGAGAAGCTGAGGTAGGAGGG - Intergenic
1135569144 16:23535009-23535031 GTTGAGGAGCAGGGGCAGGTGGG + Exonic
1135710935 16:24716559-24716581 CTTGGGGAGCTGAGGCAGAAGGG + Intergenic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137678044 16:50313886-50313908 CCTGAGAAGCAGGGGCAGCCTGG + Intronic
1137689067 16:50407659-50407681 CTTGACTAGGAGAGCCAGCAGGG + Intergenic
1138244986 16:55460705-55460727 CTTGGGGAACAGAGACCGCAGGG + Intronic
1138630034 16:58286217-58286239 CTTGAGAAGCCAAGACAGCAAGG + Intronic
1140137676 16:72222213-72222235 CTTGAGAAGGTGAGGCAGGAAGG - Intergenic
1141545078 16:84761456-84761478 CATGCGGAGCAGAGTCAGGAAGG + Intronic
1141685164 16:85565958-85565980 AGTAAGGAGCAGAGGCAGGATGG - Intergenic
1141737107 16:85861051-85861073 GTTGGGGAGCAGAGGCTGCAGGG + Intergenic
1142192461 16:88724148-88724170 GCTGAGGAGCAGAGCCAGCGCGG + Intronic
1142822219 17:2479272-2479294 CTTGTGGGGCCGAGGCAGGAGGG - Intronic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1143366205 17:6410290-6410312 TATGAGGAGCAGTGACAGCAGGG + Intronic
1144014690 17:11182704-11182726 CTTGAGGAGCACAGCCAGTTTGG - Intergenic
1144036485 17:11370612-11370634 CTTGAGGAGCACAGGCAAGATGG - Intronic
1144755449 17:17677761-17677783 CCTCATGAGCAGAGGCAGGAAGG + Intergenic
1145281642 17:21472269-21472291 CTTGGGGTCCAGAAGCAGCAAGG - Intergenic
1145395794 17:22493354-22493376 CTTGGGGTCCAGAAGCAGCAAGG + Intergenic
1146184924 17:30718527-30718549 CTTGGGAGGCTGAGGCAGCAGGG - Intergenic
1146510098 17:33439535-33439557 CTTGGGGAGCTGAAGAAGCAGGG - Intronic
1147327358 17:39675878-39675900 CAAGAGGAGCAGAAGCAGCAAGG - Intronic
1147375215 17:40018964-40018986 GAAGAGGAGCAGAGGCGGCAGGG - Intergenic
1147403108 17:40192670-40192692 TTTGAGGATCAGAGGCACGAAGG - Exonic
1148208659 17:45795055-45795077 CTGGAGGAGCTGACCCAGCAGGG + Intronic
1148909159 17:50931235-50931257 CAGGAGGTGCAGGGGCAGCAGGG + Intergenic
1149604216 17:57913578-57913600 AGGGAGGAGCAGAGGCTGCAGGG + Intronic
1150194538 17:63281931-63281953 CTTGAGCCTCAGAGGGAGCATGG + Intronic
1150704798 17:67477181-67477203 CTTGGGGGGCTGAGGCAGGAGGG - Intronic
1151335595 17:73437912-73437934 CCTGAGGGGTAGGGGCAGCACGG - Intronic
1151418484 17:73982292-73982314 CTCAAGGAGAAGAGGGAGCAAGG + Intergenic
1151480813 17:74369225-74369247 AGTGAGGAGAAGAGGCAGGATGG - Intronic
1151628849 17:75296141-75296163 GTGGAGGTGCAGAGGCAGCAAGG - Intergenic
1151880280 17:76890577-76890599 CCTGAGAGGCAGAGGCTGCAGGG - Intronic
1151980070 17:77503371-77503393 CTGGAGCAGGAGAGGAAGCAGGG - Intergenic
1152092120 17:78252814-78252836 CTTCAGGAGCAGAAGCAGACTGG - Intergenic
1152236508 17:79141859-79141881 CTTGGGGTGCCCAGGCAGCAGGG - Intronic
1152950396 17:83226999-83227021 CTTGGGTGGCAGAGGCAGCCTGG - Intergenic
1153273560 18:3346892-3346914 CTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1153810881 18:8750533-8750555 CTGGAGGTGCAGAGGAAGGAAGG + Intronic
1154271469 18:12924120-12924142 CTTGAGGGGCTGAGGCAAGAGGG - Intronic
1154489985 18:14914082-14914104 CTTGAAGAGCTGTGACAGCAGGG - Intergenic
1156160295 18:34350944-34350966 CAGGAGGGGCAGAGGCAGCAGGG - Intergenic
1156353745 18:36323171-36323193 GAGGAGGAGCAGAGGCAGCCGGG - Intronic
1156356456 18:36346256-36346278 CTTGGGGGGCTGAGGCAGGAGGG + Intronic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157429788 18:47615266-47615288 CCTGAGGCACAGAGGGAGCAAGG + Intergenic
1157933128 18:51845123-51845145 CTGGAGGAGCAGTTCCAGCAAGG - Intergenic
1157963218 18:52179753-52179775 GTCGGGGAGCAGAGGCAGAAAGG - Intergenic
1158504962 18:58039304-58039326 CTCAAGGAGCTGAGGCAGGAGGG - Intergenic
1159556804 18:69954509-69954531 CTTTAGGATTTGAGGCAGCACGG - Intronic
1160187784 18:76688841-76688863 CAGGAGGAGCAGAAGCAGCCGGG + Intergenic
1160225018 18:77005728-77005750 CTTGAGGGGCAGAGGGGCCAGGG + Intronic
1160507330 18:79434430-79434452 CCTGGGGTGCAGAGGGAGCATGG - Intronic
1160996379 19:1883983-1884005 GCAGAGGAGCAGAGGCAGGAAGG - Intronic
1161139973 19:2641434-2641456 CCTCAGGAGAAGAGGCAGGAGGG + Intronic
1161286120 19:3469279-3469301 AGTGAGGGGCAGAGGCTGCAGGG + Intergenic
1161434488 19:4254561-4254583 CTTGGGGACCTGAGGCAGGAAGG - Intronic
1161923554 19:7284362-7284384 CTTGTGGAGAAAAGGCAGCGTGG - Intronic
1162094361 19:8301966-8301988 TTTTGGGAGCAGGGGCAGCAGGG - Intronic
1163000205 19:14362418-14362440 TTTGTGGGGCAGAGGCAGGAGGG + Intergenic
1163521407 19:17794171-17794193 CTTGGGGATCTGAGGCAGGAAGG + Intergenic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163783397 19:19261888-19261910 CTGGAGGAGCGGCGGCAGCAAGG + Intronic
1163816022 19:19465060-19465082 GTTGGGGGCCAGAGGCAGCAGGG - Intronic
1163847594 19:19646339-19646361 CTTGAGGGGCTGCAGCAGCAAGG + Exonic
1164960465 19:32424210-32424232 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
1165935868 19:39388707-39388729 TGTGAGGACAAGAGGCAGCAAGG + Intronic
1166146852 19:40843977-40843999 CCTGAGGAGGAGAGGCGGGAGGG + Exonic
1166151013 19:40875874-40875896 CCTGAGGAGGAGAGGCGGGAGGG + Exonic
1166155508 19:40908653-40908675 CCTGAGGAGGAGAGGCGGGAGGG + Intergenic
1166179308 19:41095738-41095760 CCTGAGGAGGAGAGGCAGGAGGG - Exonic
1166857038 19:45787393-45787415 CCTGATGATCAGAGGCAGAACGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167724017 19:51198994-51199016 TTTGAGGAGAAGATGGAGCAGGG - Intergenic
1168258793 19:55181398-55181420 CTTGAGGACCAAAGGCAGGAAGG - Exonic
925394305 2:3521381-3521403 CTTGACCAGCCGAGGCAACATGG + Intergenic
925611318 2:5705613-5705635 GTGGAGGAGCAGGGGAAGCAGGG + Intergenic
926070926 2:9890105-9890127 CTTGATGAGCAGAGGAGACAGGG - Intronic
927139152 2:20118075-20118097 CTGGAGGAGCAGGGGGAGCCCGG + Intergenic
927167150 2:20335165-20335187 TTTGAGGGGCTGAGGCAGGAGGG - Intronic
927841665 2:26448933-26448955 CCTGAGGAGCAGAGTCAGGATGG + Intronic
927960686 2:27239105-27239127 CGTCAGGAGTAGTGGCAGCATGG - Exonic
927982263 2:27381389-27381411 CCCGAGGAGCAGAGGCGGCTGGG + Exonic
929103125 2:38336414-38336436 CTTGAGTAGCAAATACAGCAAGG + Intronic
929273618 2:40001464-40001486 CTTGAGAGGCTGAGGCAGAACGG - Intergenic
929328706 2:40651683-40651705 TTTGAGGGGCAGAGGCTGAAGGG + Intergenic
929499659 2:42479536-42479558 CTTGGGGGGCTGAGGCAGGAGGG + Intronic
929666572 2:43838502-43838524 CTGGGGGAGCAGCAGCAGCAAGG + Intronic
929802625 2:45117337-45117359 CTTCAGGAGGAGAGACGGCATGG + Intergenic
930234235 2:48873663-48873685 CTCTGGGAGCAGAGGGAGCAGGG + Intergenic
932362213 2:71118368-71118390 CCTGAGGGGCAGCGGCAGCAAGG - Intronic
933721756 2:85401625-85401647 GTTGAGGTGCACAGCCAGCACGG + Exonic
933729558 2:85446518-85446540 CCTGAGGGGCAGAGCCCGCAGGG - Intergenic
934912822 2:98274959-98274981 CCTGAGGAGCAGAGGAAGGATGG - Intronic
935060686 2:99604953-99604975 CGTGTACAGCAGAGGCAGCAAGG + Intronic
935434014 2:103008721-103008743 GACGGGGAGCAGAGGCAGCAAGG - Intergenic
936005328 2:108882044-108882066 CTCGAGAAGCTGAGGCAGGAGGG + Intronic
936471748 2:112805048-112805070 CTTGAGAGGCTGAGGCAGGAGGG + Intergenic
937150497 2:119682776-119682798 CTTGGAGAGGAGAGGCAGCAAGG + Intronic
937276218 2:120685772-120685794 CTTGAGAAGCTGAGGCTGCAGGG - Intergenic
937543680 2:122989300-122989322 CAGGGGGAGCTGAGGCAGCAGGG - Intergenic
938199592 2:129362082-129362104 CTGGAGGAGCAGAGGCTGTGGGG - Intergenic
938213004 2:129484386-129484408 CCTGAGGAGCAGGGGCTGGATGG - Intergenic
938768531 2:134480228-134480250 CTTGAGGAACAGAGGAGGCAGGG - Intronic
938831612 2:135055475-135055497 CAAGAGGAGCTGGGGCAGCATGG + Intronic
939900801 2:147846855-147846877 CTTGAGGAGGAGGGGCATCATGG + Intronic
940021629 2:149162037-149162059 CTTGAGGATCAGAGGAATGACGG + Intronic
940711503 2:157167703-157167725 CAAGTGAAGCAGAGGCAGCAAGG + Intergenic
940746957 2:157578008-157578030 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
941762947 2:169264874-169264896 CTGGAGGAGCTGAAGCAGAATGG + Intronic
941857045 2:170241921-170241943 TGTGAGATGCAGAGGCAGCAGGG + Intronic
942133141 2:172900094-172900116 CTCGAGAGGCAGAGGCAGAATGG + Intronic
943038835 2:182779499-182779521 CTTGAGAGGCTGAGGCAGGAGGG + Exonic
943562852 2:189484011-189484033 CTTGGGCAGCACCGGCAGCAAGG - Intergenic
943600422 2:189912463-189912485 CCTGAGAGGCAGAGGCTGCAGGG + Intronic
945249181 2:207749115-207749137 CTTCAGGAGCAGTGGTGGCAGGG + Intronic
945513858 2:210737439-210737461 CTTGGGCAGCTGAGGCAGAAGGG - Intergenic
947747924 2:232518896-232518918 CCTGAAGACCAGAGGCAGGAGGG + Intergenic
947900048 2:233713663-233713685 CATAAGGAGCAGAAACAGCATGG - Exonic
947956999 2:234200903-234200925 CATGAGGAGCAAGGGGAGCAAGG + Intergenic
947982287 2:234420693-234420715 CTTGCAGTGCAGAGGCTGCAAGG + Intergenic
947982497 2:234422296-234422318 CTCAAGGAACAGAGACAGCATGG - Intergenic
948015087 2:234682596-234682618 CTCGTGGAGCAGAGCCAGCAGGG - Intergenic
948449510 2:238060648-238060670 CCTGAGGAGCAGAGGCGGCTGGG - Intronic
1169195257 20:3679343-3679365 CTTGAGGGGCAGGGGAGGCAGGG + Intronic
1169198884 20:3698003-3698025 CTTGTGGAGCAGCTGCAGCCTGG + Exonic
1169318230 20:4610597-4610619 CTGGAGGAGCAGTGGGTGCAGGG - Intergenic
1169427210 20:5505775-5505797 CTTAAGGAGCTGAGACAGGAGGG - Intergenic
1169941492 20:10942600-10942622 ATTGAAGAGCAGAGGGAGGAAGG - Intergenic
1170221488 20:13946892-13946914 CCAGAGGGGCTGAGGCAGCAGGG - Intronic
1171413690 20:24963340-24963362 ATGGAAGAGCAGAGGGAGCATGG - Exonic
1172707472 20:36892546-36892568 CTTGGGGGGCTGAGGCAGGAGGG + Exonic
1172737617 20:37139739-37139761 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1172833065 20:37853056-37853078 CTTGAGGGGCAAAGGAGGCAAGG + Intronic
1172863484 20:38076567-38076589 GCTGAGAAGCAGAGGCAGCAAGG - Intronic
1173082912 20:39886867-39886889 GTTTTGAAGCAGAGGCAGCAGGG - Intergenic
1173192563 20:40887502-40887524 ATCGAGGGGCAGAGGGAGCAGGG - Intergenic
1173711055 20:45156049-45156071 CTTCAGGAGCAGGGCCATCATGG + Intergenic
1174173403 20:48630584-48630606 CTGGAGGAGGAGAGACTGCAGGG + Intronic
1174352128 20:49976045-49976067 CTTGGGAGGCTGAGGCAGCATGG - Intergenic
1174445205 20:50586510-50586532 CCTGAGCAGCACAGGCAGTAGGG - Exonic
1174445898 20:50590888-50590910 CATGGGAAGCAGAGGCTGCAGGG - Intronic
1175705095 20:61170952-61170974 CTGGATGGGCAGAGGCAGCTGGG - Intergenic
1175921980 20:62454445-62454467 ATTCAGGAGTAAAGGCAGCAAGG + Intergenic
1176187759 20:63790675-63790697 CTCAACGAGCAGAGGCAGCACGG - Exonic
1176240785 20:64074975-64074997 CCAGGGGAGCAGAGGCAGAAGGG - Intronic
1178546066 21:33493931-33493953 CTTGAGCAGCTGGGGAAGCAAGG - Intergenic
1178692839 21:34763978-34764000 GTTGAGTAGAAAAGGCAGCAGGG - Intergenic
1178719475 21:34995546-34995568 CTTGAGAGGCTGAGGCAGGAGGG - Intronic
1179910161 21:44443212-44443234 CTTGAAGCTCAGAGGCAGCAGGG + Intergenic
1180025817 21:45161493-45161515 CTGGGGGTGCCGAGGCAGCAGGG - Intronic
1180628905 22:17213648-17213670 AATGAGGAGGAGAAGCAGCACGG + Intronic
1180666736 22:17519229-17519251 GTGGAGGAGCAGTGGCTGCACGG - Intronic
1181088353 22:20455404-20455426 CCTGAGCAGGAGAGGAAGCATGG - Intronic
1181182135 22:21075773-21075795 CTTGAGAAGCAGCCGCAGCCAGG + Intergenic
1181235494 22:21445738-21445760 CGGGAGGAGCAGAGGCCGCAGGG - Exonic
1182937028 22:34233795-34233817 CTTGAGGGGCAGGGGCAGAGGGG + Intergenic
1183001091 22:34859825-34859847 CTGGAGGAGCAGAGGAAGCGCGG - Intergenic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183554303 22:38513244-38513266 CAGGGGGAGCAGGGGCAGCAGGG - Intergenic
1184039709 22:41935578-41935600 CTTGAGGAGGGGAGGCTCCAGGG - Intergenic
1184250919 22:43259873-43259895 CCTGAGGAGAAGAGGCTGGAGGG - Intronic
1184508588 22:44918727-44918749 TTTGTGGGGCAGAGACAGCAAGG + Intronic
1184520450 22:44990977-44990999 GTGGAGGAGCCGCGGCAGCAGGG - Intronic
1184857580 22:47154815-47154837 CTTTAGGAGCAGAAGCAGCCTGG + Intronic
1185088447 22:48753114-48753136 CATGGGGAGCAGAGGGAGCTTGG - Intronic
949114851 3:308833-308855 CTGGAGGAGCAGTTCCAGCAGGG - Intronic
950057061 3:10033803-10033825 CTTGGGAAGCTGAGGCAGAATGG - Intronic
950350513 3:12346740-12346762 CTTGAGAGGCTGAGGCAGGAGGG - Intronic
950635783 3:14313506-14313528 ATTGAGGAGGAGAGGAAGGAAGG - Intergenic
951650984 3:24951235-24951257 CTTTAGGAGGGGAGGCAGAAAGG + Intergenic
952311723 3:32196702-32196724 CTTGAGGAGGACAGTCAGAATGG + Intergenic
952367772 3:32689991-32690013 CATAGGGAGCAAAGGCAGCATGG + Intronic
952376614 3:32772971-32772993 CTTGGGGGGCTGAGGCAGGAGGG - Intronic
952777641 3:37061496-37061518 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
952960799 3:38588005-38588027 CCTGAGGAGCAGGAACAGCAAGG - Intronic
953146689 3:40283074-40283096 CTTGGGAAGCTGAGGCAGAATGG - Intergenic
954136108 3:48582914-48582936 GGTGAGGAGCAGGGGTAGCAGGG + Intronic
954756010 3:52840376-52840398 CAAGAGGAGCAGAGGTAGAAAGG + Exonic
955274038 3:57530466-57530488 CTGGAGGAGCAGTTCCAGCAGGG - Intronic
955317597 3:57951799-57951821 CTGGAGGGGCAGAGGCAGCCTGG - Intergenic
955397857 3:58569656-58569678 CTTGCGGGGCCCAGGCAGCAGGG + Intronic
955993079 3:64649348-64649370 AGTGAGGCTCAGAGGCAGCAAGG - Intronic
956404751 3:68916747-68916769 CTTGAGGATAAGAGGCAGAAGGG - Intronic
956800905 3:72757495-72757517 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
956916547 3:73877956-73877978 CTTGAGGAGCTGTGGCAGAATGG + Intergenic
960588792 3:119345659-119345681 CTTGATGAGCAAAGGAAGCTGGG + Intronic
961550713 3:127669245-127669267 TTTGAGGAACAGAGACAGGAGGG - Intronic
961588344 3:127954726-127954748 CAGGAGGAGCTGAGGCTGCAGGG - Intronic
961749574 3:129087357-129087379 CCTGAGGGGCAGAGGAAGCTTGG - Intergenic
962445309 3:135458458-135458480 CCTGAGGAGCAGAGGAAACATGG - Intergenic
962808083 3:138940833-138940855 CTTGAGCATCAGTGGCAGCTAGG + Intergenic
963433390 3:145237610-145237632 CTGGAGAAGGAGAGGCAGAATGG - Intergenic
963764907 3:149324454-149324476 CTTGAGGAGGAGAGAAACCATGG - Intronic
964518674 3:157540956-157540978 ATTGGGGAGGAGAGGCTGCATGG - Intergenic
965145766 3:164900909-164900931 CTTGAGCACCAGACACAGCACGG + Intergenic
965789461 3:172372281-172372303 CTTCATGGGCACAGGCAGCAGGG + Intronic
966264568 3:178023571-178023593 CTTGAGGATCAGTGGTAACAGGG + Intergenic
966465555 3:180227754-180227776 ATTCAGGAGCTGAGGCAGCCAGG - Intergenic
966494943 3:180569317-180569339 TGTGATGAGCAGAGGAAGCAGGG - Intergenic
967173728 3:186844164-186844186 CTTAAGGAAGAGTGGCAGCAGGG - Intronic
968476427 4:811737-811759 CTTGAGCAGCACAGCCAGCCAGG - Intronic
968628815 4:1639662-1639684 CTTGCAGGGCAGAGGCAGGAGGG + Intronic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
971114904 4:23633663-23633685 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
971262867 4:25072964-25072986 CTTGAGGACCAGAGGCTCCTGGG + Intergenic
971689449 4:29814245-29814267 CTTGGGGGGCTGAGGCAGGAGGG - Intergenic
971713464 4:30146705-30146727 TTTGAGAAGCTGAGGCAGGAGGG + Intergenic
971760607 4:30760104-30760126 CTTGAGAAGCAGAGGAACAATGG - Intronic
972032991 4:34486081-34486103 CTTGGGAAGCAGAGGCAGGAGGG - Intergenic
973333324 4:48931631-48931653 ACTGTGGAGGAGAGGCAGCAAGG - Intergenic
973637285 4:52871710-52871732 CTTGAGGAGCTGAGCCAGGCCGG - Intergenic
974052242 4:56952115-56952137 CTTGGGGGGCTGAGGCAGAATGG - Intergenic
974310092 4:60194682-60194704 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
974423707 4:61712283-61712305 CTTGAGAGGCTGAGGCAGGAGGG + Intronic
974585617 4:63872649-63872671 TTTGAGAAGCTGGGGCAGCAGGG - Intergenic
974715243 4:65660992-65661014 GTAGAGGAGCAGAGGAAGCCTGG - Intronic
975174416 4:71270965-71270987 CTGGAAGAGAAGAGGCAGGATGG - Intronic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
977359025 4:95980871-95980893 CCAGAGGGGCTGAGGCAGCAGGG - Intergenic
977848006 4:101789300-101789322 ATTGTGGAGCAGAGTCAGGATGG + Intronic
979647524 4:123088753-123088775 CTGAAGGAGAAGAGGAAGCAAGG - Intronic
980734822 4:136870913-136870935 CTTGTGGAGTAGAGCCACCAAGG - Intergenic
981251844 4:142612212-142612234 CTTCAGAGGCAGAAGCAGCAGGG - Intronic
982103628 4:151992643-151992665 CTTCAGGAGCAGAGGTGGAAGGG - Intergenic
982710466 4:158753561-158753583 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
982743959 4:159087006-159087028 CTTGAGAGACAGAGGCAGGAGGG + Intergenic
983682719 4:170372105-170372127 CTTGAGAGGCTGAGGCAGGAGGG - Intergenic
985182122 4:187276129-187276151 CTTAAGGAACAGAGGTATCATGG + Intergenic
986156059 5:5177060-5177082 CATGAGGAGGAGAGGAGGCAAGG - Intronic
986248113 5:6029433-6029455 CTGGAAGAGCAAAGGCAGCTGGG + Intergenic
988099244 5:26656822-26656844 CTTCAGGAGCAGAGCCCTCATGG - Intergenic
989774854 5:45192748-45192770 CTTGAGGAGATGAGACATCAAGG - Intergenic
990358667 5:54996299-54996321 CATGGGGAGCTGGGGCAGCAGGG - Intronic
990599831 5:57347042-57347064 CATAAGGACCATAGGCAGCATGG + Intergenic
991279923 5:64901351-64901373 CTTGGGAAGCTGAGGCAGAATGG + Intronic
991441842 5:66658912-66658934 CTTGAGAGGCAGAGGCAGGAGGG + Intronic
992134960 5:73735379-73735401 ATTTAGTAGCAGAGGCAGCCAGG + Intronic
992344963 5:75867288-75867310 CTTCAGTAGCAGATGCAACAGGG + Intergenic
992911175 5:81397448-81397470 CCTGAACAGCAGAGGCAGCCGGG + Intergenic
992915419 5:81446737-81446759 TTAAAGGAGTAGAGGCAGCATGG - Intronic
992987789 5:82251244-82251266 GCTGAGGGGTAGAGGCAGCAAGG + Intronic
993319849 5:86458841-86458863 CTTGGGGAGAAGAGGCAGGGTGG - Intergenic
995442624 5:112208573-112208595 CTAGAGGAGGAGAGGGGGCAAGG + Intronic
995655957 5:114426072-114426094 CTTGGGGAGCTGAGGCAGGAGGG + Intronic
996383396 5:122885247-122885269 CTTGGGGAGGAGAGGCAGGGAGG - Intronic
996616703 5:125450626-125450648 ATTGAAGAGCAGAGGGAGGAAGG + Intergenic
996715622 5:126585457-126585479 CTTGGGGAGAAGAGAGAGCAAGG - Intronic
997377598 5:133408473-133408495 CTGGTGGAGCAGAGGGAGAAGGG + Intronic
997508632 5:134437894-134437916 ATAGAGGAGCAGAAGCATCAGGG - Intergenic
997718851 5:136062230-136062252 CTTCAAGAGGAGAGGCTGCAGGG + Intronic
997846495 5:137291221-137291243 CTGGAGGAGCAGAGCCACCAGGG + Intronic
998101704 5:139440010-139440032 CCTGAGGAGCTGGGGCAGTAGGG - Intronic
998134470 5:139667518-139667540 GTTGAGGGGCAGAGCCAGCCTGG + Intronic
1000080357 5:157839495-157839517 CTTGAGAGGCTGAGGCAGAATGG + Intronic
1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG + Intronic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1002043952 5:176531937-176531959 TCTGAGAGGCAGAGGCAGCAAGG - Intronic
1002199883 5:177521714-177521736 CTTCAGGAGCATGGGCAGCAGGG + Intronic
1002343983 5:178535561-178535583 CTGGAGGGGCTGAGGCACCAGGG - Intronic
1002744628 5:181460814-181460836 CTTGGGTGGCAGAGGCAGCCTGG - Intergenic
1002772374 6:300984-301006 CTTTGGCAACAGAGGCAGCAGGG - Intronic
1002911399 6:1493817-1493839 CTTGGGGGGCTGAGGCAGGAGGG - Intergenic
1002924759 6:1599029-1599051 CCTGGGGAGCAGAGGCTGCCTGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1005980507 6:30832905-30832927 CTTGTGGACCAGAGGAACCAGGG - Intergenic
1005991296 6:30904248-30904270 CTTGAGAGGCTGAGGCAGGAGGG - Intergenic
1006076167 6:31534115-31534137 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1006370627 6:33641644-33641666 GATGAGGTGGAGAGGCAGCAGGG - Intronic
1006495112 6:34417198-34417220 CATGCTGAGCTGAGGCAGCATGG + Intronic
1006698383 6:35951385-35951407 CTTGGGGAGCAGAGGACCCAGGG + Intronic
1006713899 6:36101328-36101350 CTTGGGAAGCTGAGGCAGGAGGG + Intronic
1006833115 6:36980898-36980920 GATGGGCAGCAGAGGCAGCAAGG + Intronic
1007661645 6:43490393-43490415 CATGAGAAGCAGCAGCAGCATGG - Intronic
1008271437 6:49494949-49494971 CTAGTGGAGCAGATGGAGCAGGG + Intergenic
1008857770 6:56112513-56112535 CTTCCCCAGCAGAGGCAGCATGG + Intronic
1009562368 6:65263791-65263813 CTTGATAGGCAGAGGCAGGACGG + Intronic
1010309548 6:74368301-74368323 CTTGAGGAGAAGAGACAAAAAGG + Intergenic
1011319387 6:86073855-86073877 CTTGAGGAGCAATGGTAGTAGGG - Intergenic
1011389375 6:86835367-86835389 ATAGAGGAGGAGAGGCAGCTGGG - Intergenic
1011795506 6:90947787-90947809 CTGGAGGGGCCAAGGCAGCATGG - Intergenic
1013372309 6:109481926-109481948 TTTGAGGATCAGAGGAAGAAAGG - Exonic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013504738 6:110788268-110788290 TTTGAGAAGCTGAGGCAGGAGGG - Intronic
1014701560 6:124695254-124695276 TTTCAGAAGCAGAGGCAGAAAGG - Intronic
1015970573 6:138739298-138739320 CTTGGGGGGCTGAGGCAGGAGGG - Intergenic
1016431384 6:143989550-143989572 CCTGAGAAGCAGAGGAACCAGGG - Intronic
1016846555 6:148573595-148573617 CTTGAGAAGCTGTGGCAGGAGGG + Intergenic
1017148389 6:151255553-151255575 TTTGAGAAGCCGAGGCAGGAGGG + Intronic
1017694341 6:156999587-156999609 CTTAAGAAACACAGGCAGCAGGG + Intronic
1018066406 6:160127599-160127621 GTTTGGGAGCAGAGGAAGCATGG + Intronic
1018115168 6:160576232-160576254 CTTGAAGAGCAAAAGCAGGAAGG - Intronic
1018147517 6:160906424-160906446 CTTGAGGAGCAAAAGTAGGAAGG + Intergenic
1019213689 6:170425894-170425916 CTTGGGTAGCAGAGCCAGCCTGG - Intergenic
1019249539 6:170734355-170734377 CTTGGGTGGCAGAGGCAGCCTGG - Intergenic
1019989416 7:4681705-4681727 CTTGTGAGGCAGAGGCAGGAGGG + Intergenic
1020359378 7:7311213-7311235 CTTGAAGAACACTGGCAGCATGG + Intergenic
1021889813 7:25176488-25176510 GTAGAGGAGTAGGGGCAGCAAGG + Intronic
1022214050 7:28240610-28240632 CTACAGGAGCAGAGGCAACCGGG + Intergenic
1022960937 7:35425933-35425955 CTTGAGTAACAGAGGCAGCTGGG - Intergenic
1023251680 7:38269992-38270014 CTCGAGAAGCTGAGGCAGGAGGG + Intergenic
1023866110 7:44239202-44239224 CTTGAGGAGCAGAGCCAGAGAGG - Intronic
1024020341 7:45362640-45362662 CTAGAGAAGCAGATGCTGCAAGG + Intergenic
1025845627 7:65194075-65194097 ATTCAGGAGCACAGGCAGAATGG + Intergenic
1025895847 7:65699788-65699810 ATTCAGGAGCACAGGCAGGATGG + Intergenic
1025957037 7:66190980-66191002 CCTGAGAAGCAGAGGTTGCAGGG - Intergenic
1025980216 7:66399145-66399167 CTTGTTGAGAAGAGGGAGCAAGG - Intronic
1026942502 7:74295337-74295359 GTTGAGAAGCTGGGGCAGCAGGG + Intronic
1027205097 7:76091518-76091540 CTTGTTGAGAAGAGGGAGCAAGG - Intergenic
1028394125 7:90348610-90348632 CTTGGGTGGCAGAGGCAGAAGGG + Intronic
1028844419 7:95463273-95463295 TTTGGGAAGCAGAGGCAGGAGGG - Intergenic
1028992942 7:97069428-97069450 CTTGAGGAGAAGAGTCAGAGGGG - Intergenic
1029477563 7:100794041-100794063 CCTGGGGAGCAGAGGCGCCAAGG + Intronic
1030236620 7:107270367-107270389 CTTGGGAAGCTGAGGCAGGAAGG - Intronic
1030927479 7:115476639-115476661 TTTGATCAGCAGTGGCAGCAGGG - Intergenic
1031881015 7:127198780-127198802 CTTGGGAAGCTGAGGCAGGAGGG - Intronic
1032081642 7:128861762-128861784 CTCGAGAAGCTGAGGCAGCAGGG - Intergenic
1032743121 7:134759501-134759523 CCTGAGGACAAGAGGCAGCAAGG + Intronic
1032850309 7:135789281-135789303 ATTTAGGAGCAGAGGCATCAAGG + Intergenic
1032977431 7:137241832-137241854 CTTGGCCAGAAGAGGCAGCATGG - Intronic
1034204845 7:149306403-149306425 CTGGAGGAGGAGAGGGAGCTGGG + Intergenic
1034574368 7:151984693-151984715 TTTGAGCAGAAGAGGCAGCGTGG - Intronic
1034803070 7:154064940-154064962 TTTGAGGAGGAGACGCTGCAAGG - Intronic
1035081729 7:156221921-156221943 TAACAGGAGCAGAGGCAGCATGG - Intergenic
1035236934 7:157503405-157503427 CTCCAGGAGCAGAGGCTGCAAGG + Intergenic
1035498557 8:73301-73323 CTTGGGTGGCAGAGGCAGCCTGG + Intronic
1035597352 8:869090-869112 CTCGAGGAGGAGAGGAAGGAAGG - Intergenic
1036479420 8:9125097-9125119 CTTGAGGGCAAGAGGCAGTATGG + Intergenic
1036690698 8:10943024-10943046 CTTCAGGACCATAGGCTGCATGG + Intronic
1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG + Intronic
1037203188 8:16282803-16282825 CTTGAAGACCAAAGGCAGAATGG + Intronic
1037493084 8:19413817-19413839 CTTGAGGAGCAGAGACAGCCAGG + Intronic
1037897923 8:22670434-22670456 CTTGAGCAGGAGAGGTAGGAGGG + Intergenic
1039834657 8:41246900-41246922 AGTGAGGTGCAGAAGCAGCAGGG - Intergenic
1041036091 8:53792168-53792190 CATGAAGAGCAGAGCCACCATGG + Intronic
1041675077 8:60530251-60530273 CTTGAGAGGCTGAGGCAGAACGG - Intronic
1042226365 8:66517966-66517988 GTTGAAGAGCAGAGATAGCAAGG - Exonic
1042474521 8:69232167-69232189 ATTGAGGAGGAATGGCAGCAGGG - Intergenic
1044839155 8:96323263-96323285 AGAGAGGAGCAGTGGCAGCAGGG - Intronic
1044954758 8:97468407-97468429 TTTGAGGAACAGAAGAAGCAGGG - Intergenic
1046439527 8:114239997-114240019 TTTGAGAAGCTGAGGCAGGAAGG + Intergenic
1047725449 8:127680093-127680115 CATGAGAAATAGAGGCAGCAAGG - Intergenic
1048436327 8:134421908-134421930 CATGAGCAGCAGAGGCAACATGG + Intergenic
1048529416 8:135234082-135234104 CTGGAGGAGGAGAGGAAGGAAGG - Intergenic
1049015895 8:139919824-139919846 CTTGAGGGCCCAAGGCAGCACGG + Intronic
1049029356 8:140023019-140023041 CTGGAGGAGGAGGGGCTGCACGG + Intronic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049372622 8:142274968-142274990 GCAGAGGAGCAGAGGCTGCAGGG + Intronic
1049389131 8:142359112-142359134 GTGGAGGAGCAGGGGCAGCATGG - Intronic
1049414256 8:142488156-142488178 GTCCAGGAGCAGAGACAGCAAGG - Intronic
1049573481 8:143380154-143380176 CTGGAGGAGCGCAGGCAGCTTGG + Exonic
1049654016 8:143789848-143789870 CTTCGGGAGCAGACGCAGGAGGG + Intergenic
1049673854 8:143881082-143881104 CGTGGGGGACAGAGGCAGCAGGG - Intergenic
1049910169 9:258199-258221 CTTGAATAGCAGAGGCTGGAAGG + Intronic
1050174872 9:2859264-2859286 CTTGAGGTGCTGAGGCACAAGGG + Intergenic
1050725430 9:8643726-8643748 CTGGGGGTGCTGAGGCAGCAAGG - Intronic
1051188651 9:14487469-14487491 CTTGTGGAGCACAGGCAGTTAGG + Intergenic
1051222870 9:14868924-14868946 CAGGAGGAGCAGCAGCAGCACGG + Exonic
1051243708 9:15086849-15086871 CTTGAGGAACAGATGTAGCAAGG - Intergenic
1051258935 9:15243027-15243049 CTTTGGTGGCAGAGGCAGCAAGG + Intronic
1052192702 9:25677788-25677810 CTCGAGGTGCAGCTGCAGCAGGG + Exonic
1052337845 9:27337941-27337963 CTCTAGGACCACAGGCAGCATGG - Intronic
1052715117 9:32106496-32106518 TTTTAGGAGCATGGGCAGCATGG - Intergenic
1052952473 9:34224105-34224127 CTGGAGGAGCAGTTCCAGCAGGG - Intronic
1053858828 9:42364875-42364897 CTTAAGAAGCAGACGCAGTATGG - Intergenic
1055539852 9:77291837-77291859 CATGAGGAGGAGGGGCAGGATGG - Intronic
1056707730 9:88966311-88966333 CTTGGGAAGCTGAGGCAGGAGGG - Intergenic
1056796785 9:89664018-89664040 CTAGAAGAGGAGAGGCAGTAGGG + Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1059347522 9:113639712-113639734 CTTGGGGGGCTGAGGCAGGAGGG + Intergenic
1060062766 9:120475833-120475855 CCTGGGGAGCAGAGACAGTAAGG + Intronic
1060282432 9:122223384-122223406 CTTGAGGAGCAGAGCCTGCCTGG - Intronic
1060320445 9:122554093-122554115 CTTGAGGAACAGAGACATGAAGG + Exonic
1060423077 9:123483352-123483374 CTGGAGCAGCAGCGGCGGCATGG - Intronic
1060515509 9:124263313-124263335 CCTGAGGCTCAGAGGGAGCAAGG + Intronic
1060624090 9:125094607-125094629 CTTGGGGAGCTGAGGCGGAAGGG - Intronic
1060759341 9:126234845-126234867 CTTGAGGGGCAGAGACAGTGGGG + Intergenic
1061302049 9:129711006-129711028 CTTCAGGCACACAGGCAGCAGGG - Intronic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1061611794 9:131751566-131751588 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1061634918 9:131901527-131901549 CTTGAGGAACGGAGGGAGGAGGG + Intronic
1061639880 9:131944637-131944659 CTTGGGAGGCTGAGGCAGCAGGG - Intronic
1061974470 9:134061403-134061425 CTGGAGGAGCAGTGGCAGGGAGG + Intronic
1062635345 9:137487687-137487709 CCAGAGGAGCAGAGGCTGCCAGG - Intronic
1203610439 Un_KI270748v1:91293-91315 CTTGGGTGGCAGAGGCAGCCTGG - Intergenic
1185920709 X:4088870-4088892 ATTCAGAACCAGAGGCAGCAAGG - Intergenic
1187010104 X:15269938-15269960 TTTCAGGAGCAGGGGGAGCATGG - Exonic
1187048672 X:15675067-15675089 AGTGAGGAGCGCAGGCAGCAAGG + Intergenic
1187722804 X:22169639-22169661 CTGGAGGAACAGAGGCATCAGGG + Intronic
1188107389 X:26160891-26160913 CTTGAGAAACGGAGGCATCACGG - Intergenic
1188107408 X:26161017-26161039 CCTGAGGAACAGAGGCATCACGG - Intergenic
1188110785 X:26194137-26194159 CCTGAGGAACGGAGGCATCACGG - Exonic
1189470963 X:41313827-41313849 CTTGGGAAGCTGAGGCAGGAGGG + Intergenic
1189629328 X:42934703-42934725 CTTTTGGAGAAGAGGCAGCTGGG + Intergenic
1191699756 X:64028048-64028070 CTTGGGCAGCTGAGGCAGCAGGG + Intergenic
1192534767 X:71917836-71917858 ATTCAGGAGGAGAGGGAGCAAGG + Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1194084167 X:89505674-89505696 CTTGAGGAGCAGAGCCCTCATGG - Intergenic
1194886130 X:99318348-99318370 CTGCAGGAGCAGAGCCATCATGG + Intergenic
1195365849 X:104124644-104124666 CTTGGGGAGCTGAGGCAGGAGGG + Intronic
1199258890 X:145748122-145748144 CTTCAGGAGCAGAGCCCTCATGG - Intergenic
1199686046 X:150266565-150266587 CCAGAAGAGCAGAGGCAGTAAGG - Intergenic
1200232819 X:154452914-154452936 CTTCAGCTGCAGAGTCAGCATGG + Intergenic
1200436810 Y:3161560-3161582 CTTGAGGAGCAGAGCCCTCATGG - Intergenic
1201493201 Y:14565097-14565119 CTGGAGGAGGAGAGGCATCCTGG - Intronic
1202051051 Y:20781187-20781209 CTTGAGGGTCAGAGGAAGAACGG - Intergenic
1202075359 Y:21031950-21031972 CTTGAGAACCACAGGGAGCAGGG - Intergenic