ID: 1122451303

View in Genome Browser
Species Human (GRCh38)
Location 14:101810157-101810179
Sequence AGACTTAACCAGAGGAGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122451296_1122451303 9 Left 1122451296 14:101810125-101810147 CCTTTCTAGCAGAATTCACCCCA 0: 1
1: 0
2: 2
3: 13
4: 157
Right 1122451303 14:101810157-101810179 AGACTTAACCAGAGGAGGTTGGG 0: 1
1: 0
2: 0
3: 14
4: 111
1122451298_1122451303 -10 Left 1122451298 14:101810144-101810166 CCCATTTCGCTGCAGACTTAACC 0: 1
1: 0
2: 1
3: 3
4: 102
Right 1122451303 14:101810157-101810179 AGACTTAACCAGAGGAGGTTGGG 0: 1
1: 0
2: 0
3: 14
4: 111
1122451297_1122451303 -9 Left 1122451297 14:101810143-101810165 CCCCATTTCGCTGCAGACTTAAC 0: 1
1: 0
2: 0
3: 5
4: 125
Right 1122451303 14:101810157-101810179 AGACTTAACCAGAGGAGGTTGGG 0: 1
1: 0
2: 0
3: 14
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122451303 Original CRISPR AGACTTAACCAGAGGAGGTT GGG Intronic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
907223179 1:52921831-52921853 AGACTTGAGCGGAGGAGGTCGGG + Intronic
907363910 1:53944891-53944913 GGACTTGACCTGAAGAGGTTTGG - Intronic
908474709 1:64476013-64476035 TGACTTCACCAGAGGGGCTTGGG - Intronic
913267054 1:117055473-117055495 AGAATGAAACAGAGGAGGGTGGG + Intergenic
915123483 1:153647525-153647547 AGGCTGACCCAGAGGAGGTCAGG - Intergenic
915322727 1:155064462-155064484 AGACTTGCCCAGAGGTGATTCGG - Intronic
917840040 1:178970127-178970149 GGATTAAACCAGAGGAGGTGGGG - Intergenic
919101606 1:193103932-193103954 AGCCTAAACCAGAAAAGGTTAGG + Intronic
920680630 1:208069744-208069766 AGATATAACCAGAGGAAGATAGG - Intronic
920752257 1:208690159-208690181 AGATATGACCAGAGGAGGTTGGG - Intergenic
922237907 1:223735581-223735603 AGGCTGGACCAGAGGTGGTTGGG - Intronic
922514343 1:226195689-226195711 AGAGCTAACCAGAGTAGGTGAGG + Intergenic
1063159864 10:3411421-3411443 AGACTTAAGCAGACGAGGAGGGG + Intergenic
1063740105 10:8807977-8807999 AGACTGAGCAAGAGGAGGTAGGG + Intergenic
1064810849 10:19196611-19196633 AGAGTTCACATGAGGAGGTTAGG - Intronic
1067158278 10:43801043-43801065 AGTCTTAACCAGAGGAGCTGAGG + Intergenic
1067158358 10:43801680-43801702 AGTCTTAACTAGAGGAGCTGAGG + Intergenic
1068073187 10:52221926-52221948 AAACTGAAGCAGAGGTGGTTAGG + Intronic
1068242629 10:54323855-54323877 AACATTAACCAGAGGAAGTTGGG + Intronic
1068269793 10:54706588-54706610 AGACTTAACCACAGGAAATGGGG + Intronic
1073303937 10:102488144-102488166 AGACTTTCTCAGAGGAGGTGAGG - Exonic
1074756846 10:116629970-116629992 AGGATGAACCTGAGGAGGTTCGG + Exonic
1074869359 10:117564838-117564860 AGACTCAGCCAGAGCAGGCTTGG + Intergenic
1080077695 11:28170898-28170920 AGGCTGAAACACAGGAGGTTAGG - Intronic
1080943017 11:36940287-36940309 AGATTTAAACTGAGGAAGTTTGG - Intergenic
1081311424 11:41578619-41578641 AAACTTAAACAAAGGAGGTCAGG - Intergenic
1083737319 11:64688833-64688855 AGACCTTCCCAGAGGAGGTCTGG - Intronic
1090153406 11:124409771-124409793 AGACTTAGCCAGAGGACTTTGGG + Intergenic
1094242973 12:28250119-28250141 AGACTTAACCAAAGAGGGTGAGG + Intronic
1104085505 12:125470964-125470986 AGGCTTAACCAGAGCTGGTCAGG - Intronic
1105910690 13:24863390-24863412 TGACTTGAACAGTGGAGGTTTGG + Intronic
1106158359 13:27178238-27178260 AGACTTGACCAGAGGGAATTGGG - Intergenic
1107534985 13:41320490-41320512 AGACGAAACCAGAGCAGGCTGGG - Intronic
1110163362 13:72406675-72406697 AGTTTTAACCAAAGGAGGTTAGG - Intergenic
1112702785 13:102030981-102031003 TGACTTAAGCACAGGATGTTTGG + Intronic
1113105322 13:106765729-106765751 AGAATGAAGGAGAGGAGGTTAGG + Intergenic
1115294795 14:31813280-31813302 AGAATTAACCAGAGCTGGCTGGG - Intronic
1115818400 14:37187907-37187929 AGGGTTAACCAAAGGAGGATGGG + Intergenic
1117611695 14:57489701-57489723 AGTCCTAAACAAAGGAGGTTAGG - Intronic
1120280827 14:82435905-82435927 GGAATAAACCAGAGGAGTTTTGG - Intergenic
1122451303 14:101810157-101810179 AGACTTAACCAGAGGAGGTTGGG + Intronic
1127159549 15:56166988-56167010 AGAGTCAACCAAAGGAGGATGGG - Intronic
1134025006 16:10946608-10946630 GGAGTTATCCAGAGGAGGTTGGG + Intronic
1137690777 16:50425649-50425671 AGACTGCACAAGAGGAGGTGTGG - Intergenic
1142364290 16:89641855-89641877 AGACCTTTCCAGAGGAGGTTGGG + Intergenic
1150828643 17:68498773-68498795 AGACTGAAACTGAGGATGTTTGG - Intergenic
1152323482 17:79622384-79622406 AGACTCAGCCAGAGGAGGTGGGG + Intergenic
1153098506 18:1437114-1437136 AGACTCAACCATAGAAGGATAGG + Intergenic
1153353383 18:4107399-4107421 AGACGTAGCTAGAGGAGGGTCGG - Intronic
1154998522 18:21664537-21664559 CAACTTAACCAGAGCAGTTTAGG + Intronic
1156731573 18:40199745-40199767 AGGCTTAACCTCAGGAGGTAAGG + Intergenic
1158343879 18:56495152-56495174 AGACTAAACAAGAGGAGGAAAGG + Intergenic
1158867056 18:61648298-61648320 AGACTTAAATAGAGGCGTTTGGG + Intergenic
1167586230 19:50377232-50377254 AGTCTTAAGAAGAGGAGGTGGGG + Intronic
1168445245 19:56406020-56406042 AGAATTCACCATAGGGGGTTTGG + Intronic
926024326 2:9527311-9527333 AAACCTAACCAGAGGTGTTTTGG + Intronic
929103596 2:38341551-38341573 TCACTTGAGCAGAGGAGGTTGGG + Intronic
929948796 2:46390344-46390366 AACCTTAACAAGAGCAGGTTTGG + Intergenic
935353131 2:102172375-102172397 ACACTAAACAAGAGGAGATTGGG - Intronic
935813251 2:106820808-106820830 AGAATTAACAAGAGGAATTTTGG + Intronic
937095841 2:119234660-119234682 AGAATTTGTCAGAGGAGGTTTGG + Intronic
937264433 2:120607071-120607093 AGGCTGAGCCAGAGGAGGCTGGG + Intergenic
937446013 2:121958518-121958540 AGCCTTAGGCAGAGCAGGTTAGG - Intergenic
941528773 2:166638337-166638359 ACACTTAACCAGTGGATGTAGGG + Intergenic
947291568 2:228581851-228581873 AGACTTAATCAGGGGATCTTGGG - Intergenic
947933316 2:233982442-233982464 AGACAGAAACAGGGGAGGTTTGG - Intronic
1170029203 20:11927237-11927259 ATACTTGCCCAGAGGAGTTTTGG + Intergenic
1173756766 20:45523306-45523328 AGACACAACCAGAGGAAGATGGG - Intergenic
1180504230 22:15977653-15977675 AGACTTTACCAGTGGATATTAGG + Intergenic
1180873506 22:19162076-19162098 AGACTTCAGCAGAGGAGGTCTGG + Intergenic
1183587629 22:38762281-38762303 AGAATCAAACAGAGGAGGATGGG - Intronic
1184348966 22:43930818-43930840 AGACATCCCCAGAGGGGGTTGGG - Intronic
1203334347 22_KI270739v1_random:44859-44881 AGACTTTACCAGTGGATATTAGG - Intergenic
949862484 3:8518834-8518856 TGGCGTAACCAGAGGAGGCTAGG + Intronic
953934952 3:47033321-47033343 AAACTCAACCAGAGAAAGTTAGG - Intronic
960898877 3:122534189-122534211 AAACTTAACCAGAAGAAATTAGG + Intronic
961734921 3:128995290-128995312 AGACTGAACCCGAGGAGTATTGG - Intronic
967896379 3:194399342-194399364 AGACTTTACCAGAGTAGGTCAGG + Intergenic
970559638 4:17269887-17269909 AGAGTTAACTAGATGAGGTGTGG - Intergenic
975855263 4:78617770-78617792 AAATTAAAGCAGAGGAGGTTAGG - Intergenic
977669324 4:99677668-99677690 AGAAATAAGCAGAGGAAGTTGGG - Intergenic
980153218 4:129073952-129073974 AGACAAAACTAGAGGTGGTTGGG - Intronic
982437650 4:155397320-155397342 CGACTTAACAACATGAGGTTAGG + Intergenic
982671439 4:158324704-158324726 ACACTTGACCAGAGCAGGGTTGG + Intronic
985792035 5:1934149-1934171 AGAAAGAACCAGGGGAGGTTTGG + Intergenic
989726516 5:44593527-44593549 AAACTTAACCAAAGGCGATTAGG - Intergenic
990345012 5:54863369-54863391 AGACTTAACCAGGGGATTTGGGG - Intergenic
993158618 5:84259247-84259269 AGACTTTACCAGACCAGGTGTGG - Intronic
994840356 5:104916508-104916530 AGACTTATCAATAGGATGTTAGG + Intergenic
997440767 5:133907256-133907278 AGACCCAGCCACAGGAGGTTGGG + Intergenic
999412978 5:151368566-151368588 AGACTTATCCAGTGAAGTTTGGG - Intergenic
1000753119 5:165121775-165121797 AGACTTAATCACAGGATGATGGG + Intergenic
1003464698 6:6367676-6367698 AGACTTACCCAGAGTGGGTGGGG + Intergenic
1003521487 6:6862326-6862348 AGAGGGAACTAGAGGAGGTTGGG + Intergenic
1005894847 6:30169247-30169269 AGAGTCAACCAGAGCAGGTAGGG + Exonic
1006491943 6:34395106-34395128 AGGCTTAACTAAAGGAGGCTGGG + Intronic
1008287263 6:49669161-49669183 ACACTTAAACAGAGGGGTTTGGG - Intergenic
1009364778 6:62849483-62849505 AGAATTAACAAGAGAAGCTTTGG + Intergenic
1014636407 6:123852448-123852470 AGAGTAAAACAGTGGAGGTTGGG - Intronic
1023101348 7:36721606-36721628 AGAGTTAACCAGAAGAAGTTGGG + Intronic
1027808550 7:82861805-82861827 AGAAATAACCAGAGGAATTTTGG + Intronic
1030130580 7:106196009-106196031 ACACTTAAGCAAAGGAGGTGAGG - Intergenic
1030703865 7:112670545-112670567 AGAATTAAATAAAGGAGGTTAGG + Intergenic
1031188954 7:118521474-118521496 AGACTGAACCAGAGGACATTAGG - Intergenic
1032354454 7:131197041-131197063 AGAATTAAACAGAGGAGGATGGG - Intronic
1032724797 7:134580771-134580793 AGCCTCAACCAGAGGATGTGGGG - Intergenic
1035519615 8:266267-266289 AGCCTTCACCTGAGGAGGTGGGG + Intergenic
1038874674 8:31535009-31535031 AGACATAACCAGAGCAGGTGAGG - Intergenic
1039029211 8:33291627-33291649 AGATATGAGCAGAGGAGGTTGGG - Intergenic
1040664171 8:49612080-49612102 AGACTTAGCCAGAGGGAGTGGGG - Intergenic
1041097889 8:54367619-54367641 AGAATTAACCTGATGTGGTTAGG + Intergenic
1041667276 8:60457999-60458021 AGACTTAACTGGAAGAGGTATGG + Intergenic
1045759015 8:105581925-105581947 AGAGTTAAACAGAATAGGTTGGG - Intronic
1048688475 8:136931429-136931451 AGACTTAAGCAAGGGAGGTGGGG - Intergenic
1051575790 9:18614106-18614128 AGACTGAGCCAGAGGAAGTGAGG + Intronic
1052123516 9:24748109-24748131 ACACATACACAGAGGAGGTTAGG + Intergenic
1053688203 9:40563577-40563599 AGACTTTACCAGTGGATATTAGG + Intergenic
1054299439 9:63364488-63364510 AGACTTTACCAGTGGATATTAGG + Intergenic
1055959858 9:81809983-81810005 AGACTGATCAAGAGGAAGTTGGG + Intergenic
1056219382 9:84436058-84436080 AAACTTACCCAGAGGATGTCGGG - Intergenic
1062469918 9:136697830-136697852 AGACGGGACCAGAGGAGGATGGG + Intergenic
1189536050 X:41936603-41936625 AGCCTTCTCCAGAGGAGGTGTGG + Intergenic
1190148925 X:47924761-47924783 AGACTTTCCCAGAGAAGATTTGG + Intronic
1194497135 X:94630514-94630536 AGACATAATCGGAGGAGGTTGGG + Intergenic
1195702153 X:107713746-107713768 AGACTTAGCCATAAGAGGTAAGG + Exonic