ID: 1122464815

View in Genome Browser
Species Human (GRCh38)
Location 14:101924735-101924757
Sequence AAGAAGCAGAAATTTCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 1, 2: 5, 3: 35, 4: 482}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122464815_1122464817 -7 Left 1122464815 14:101924735-101924757 CCAGCCAGAAATTTCTGCTTCTT 0: 1
1: 1
2: 5
3: 35
4: 482
Right 1122464817 14:101924751-101924773 GCTTCTTGAAATGCTTCTGTAGG 0: 1
1: 0
2: 1
3: 20
4: 226
1122464815_1122464820 12 Left 1122464815 14:101924735-101924757 CCAGCCAGAAATTTCTGCTTCTT 0: 1
1: 1
2: 5
3: 35
4: 482
Right 1122464820 14:101924770-101924792 TAGGGGACATGCCCATGAAATGG 0: 1
1: 0
2: 1
3: 9
4: 133
1122464815_1122464819 -5 Left 1122464815 14:101924735-101924757 CCAGCCAGAAATTTCTGCTTCTT 0: 1
1: 1
2: 5
3: 35
4: 482
Right 1122464819 14:101924753-101924775 TTCTTGAAATGCTTCTGTAGGGG 0: 1
1: 0
2: 0
3: 28
4: 292
1122464815_1122464818 -6 Left 1122464815 14:101924735-101924757 CCAGCCAGAAATTTCTGCTTCTT 0: 1
1: 1
2: 5
3: 35
4: 482
Right 1122464818 14:101924752-101924774 CTTCTTGAAATGCTTCTGTAGGG 0: 1
1: 0
2: 1
3: 78
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122464815 Original CRISPR AAGAAGCAGAAATTTCTGGC TGG (reversed) Intronic
900251262 1:1671309-1671331 AATAAGCCGAAATTTCAGGATGG - Intronic
900604535 1:3517983-3518005 AAGGGGCAGAAATGTCGGGCCGG - Intronic
901028558 1:6292399-6292421 CAGAAGCCACAATTTCTGGCAGG - Intronic
901834260 1:11913616-11913638 AAGCAGCATCAATTTCTGCCAGG - Intergenic
902117977 1:14137406-14137428 CAGAACCAGAGATTTCAGGCTGG + Intergenic
902124652 1:14198611-14198633 AAGAAGAAGAAATTGATGGTTGG + Intergenic
902150230 1:14436981-14437003 AAGAAGCTGAAGTGTCAGGCAGG - Intergenic
902428982 1:16347556-16347578 AAAAAGTAGAAATTTCAGGCAGG + Intronic
902820495 1:18940274-18940296 GAGAAGCAGAAACTTGGGGCTGG + Intronic
903733594 1:25516084-25516106 ATGAAGCTGACATTTCTGTCAGG - Intergenic
903734489 1:25521702-25521724 AAGAAGAAGAAATCTCTGTTAGG - Intergenic
904662559 1:32096038-32096060 ATGAGGCAGAAACATCTGGCAGG - Intronic
905015769 1:34777363-34777385 AGGGAGCAGAAATTTAGGGCAGG + Intronic
905580275 1:39078937-39078959 AAAAAGAAGAAAATCCTGGCTGG - Intergenic
905714162 1:40133620-40133642 AAGTAGCTGAAATTACAGGCAGG - Intergenic
905741655 1:40376245-40376267 AAGCAACGGAAATTTCGGGCTGG - Intronic
906229756 1:44151915-44151937 AAGCAGCAGAAAATTCATGCTGG - Intergenic
906338782 1:44959349-44959371 GAGCAGCAGCAATTTCTAGCAGG + Intronic
908208130 1:61872000-61872022 TATAAACAGGAATTTCTGGCTGG - Intronic
908334858 1:63111422-63111444 AAGAATCAGGAGTTTGTGGCCGG - Intergenic
909888394 1:80971849-80971871 AAAAAACAGAAATTTCTGAGTGG - Intergenic
910227295 1:84948833-84948855 AAGAAAAATGAATTTCTGGCCGG + Intronic
911330766 1:96523307-96523329 AAGAAAAAGAATTTTGTGGCTGG - Intergenic
911763348 1:101642262-101642284 AAGAAGCATTACTTTCTGGTGGG + Intergenic
912618133 1:111127323-111127345 AAGAAGTAGAAAGTTATAGCTGG + Intronic
913294156 1:117302642-117302664 AAGAAAAAGAAATGTCTGGAAGG + Intergenic
914344221 1:146784720-146784742 AAGCAGCCTAAATCTCTGGCTGG - Intergenic
915079159 1:153339628-153339650 AACAAGTAGAAATTTCTTGAAGG - Intronic
916440420 1:164819480-164819502 ATGAAGGTGAAATTTCTTGCAGG - Intronic
917825674 1:178818062-178818084 GAGAAGCTGATTTTTCTGGCTGG + Intronic
917865735 1:179193345-179193367 AAAAAGCAGACATTTAGGGCTGG - Intronic
917934459 1:179851108-179851130 AACAAGCAGAGTTTTCTGGATGG - Exonic
918125994 1:181584290-181584312 TAGAGGCAGAAATTTCTTGGAGG + Intronic
918196812 1:182230472-182230494 AAGTGGCAGAAGTATCTGGCAGG + Intergenic
918713101 1:187756169-187756191 AATAAGCAGAAAGTGATGGCAGG + Intergenic
919033664 1:192278126-192278148 AAAACACACAAATTTCTGGCTGG + Intergenic
919843390 1:201625621-201625643 AAGAAGCAGAAATGCAGGGCAGG + Intronic
920127358 1:203703909-203703931 AAGAAGCTGAAACTTCAGGGTGG + Intronic
920219931 1:204389491-204389513 AAGAAGCAGCCAATCCTGGCCGG - Intergenic
920272949 1:204780524-204780546 ATGAAACTGAAATTCCTGGCTGG - Intergenic
920853500 1:209645418-209645440 AAAAAGCAGATATTTTGGGCCGG + Intronic
921808017 1:219478137-219478159 AAGAAGCAGCAAATTCTGCCTGG - Intergenic
921953678 1:220959899-220959921 AAGATGAAGATATTTCAGGCAGG - Intergenic
922464315 1:225836295-225836317 AAAAAGGAGAAAATCCTGGCCGG + Intronic
922757522 1:228104857-228104879 AAGAAACAGAAATTTCCCACAGG - Intronic
923741567 1:236659471-236659493 AAGAACCACTAATTTATGGCAGG - Intergenic
923785013 1:237058086-237058108 GAGAAGCTGATATTGCTGGCGGG + Intronic
1062953126 10:1520355-1520377 AAGAAGCACTTATATCTGGCTGG + Intronic
1063110859 10:3036090-3036112 GAGAAGCAGATATTTCAGGGTGG - Intergenic
1063802141 10:9592347-9592369 AAGAAGGAGAAGCTCCTGGCAGG + Intergenic
1063970722 10:11379635-11379657 GAGAAGCAGAGATTTCAGGTTGG - Intergenic
1064099788 10:12453482-12453504 AAAAGGAAGAAAATTCTGGCCGG - Intronic
1066038172 10:31515797-31515819 AAGAAACAGAATATTGTGGCAGG - Intronic
1066201202 10:33143986-33144008 AAGAAGGCGGAGTTTCTGGCCGG + Intergenic
1066591737 10:37002231-37002253 AAGAAGAAGAAAGTTGTGGAAGG + Intergenic
1067269487 10:44777119-44777141 AAGAAATAGAAATTTAAGGCCGG - Intergenic
1068602294 10:58968623-58968645 AAGAAGCAGAAATTGGGGGTAGG + Intergenic
1069136669 10:64775435-64775457 AAGAAGGAGAAATTATTGGAAGG + Intergenic
1069216764 10:65830994-65831016 AAGAATTAGAAGTTTCTGGGTGG + Intergenic
1069320580 10:67166808-67166830 AAAAAGCAACAACTTCTGGCCGG + Intronic
1070154602 10:73825593-73825615 CATAAGCAGAGATTTCTGGAGGG - Intronic
1070751119 10:78964521-78964543 AAGCACCACACATTTCTGGCTGG + Intergenic
1071356442 10:84801002-84801024 AATAAGAAGAATATTCTGGCTGG - Intergenic
1071428302 10:85581850-85581872 AAGAAGTAAAAGTTTCAGGCAGG - Intergenic
1073156131 10:101348213-101348235 AAAAAGAAGGAAATTCTGGCTGG + Intergenic
1074665043 10:115712568-115712590 AAGATTTAGAAATTTGTGGCTGG + Intronic
1076440982 10:130481264-130481286 CTGAAGCAGAAACATCTGGCAGG - Intergenic
1077858847 11:6157383-6157405 AAGAAGGACTAAGTTCTGGCAGG + Intergenic
1078470360 11:11581401-11581423 GGGAAGCAGAAAATCCTGGCAGG - Intronic
1078504350 11:11921072-11921094 AAGAACCAGAGAATTTTGGCAGG - Intronic
1078885863 11:15499257-15499279 AAGAATGAAAAATTTCTGGTTGG - Intergenic
1079334748 11:19561693-19561715 AAGAAGCAGAAATCTTAGGAAGG - Intronic
1079518713 11:21299405-21299427 ATTAAGCACAAGTTTCTGGCTGG - Intronic
1079640245 11:22796099-22796121 CAGAAACAGAAATGTCTGACTGG - Intronic
1080752115 11:35160190-35160212 AAGATGCTGAAATTTATTGCAGG + Intronic
1081244150 11:40743603-40743625 AAGAAGTAGACATTTTTGGAGGG + Intronic
1082206317 11:49439419-49439441 AATAACCATAAATTTCAGGCCGG + Intergenic
1082710122 11:56545192-56545214 AAAAAGCAGAAATTTTTGAAAGG - Intergenic
1082791958 11:57351940-57351962 AAGATCCTGAAGTTTCTGGCAGG + Intronic
1083697770 11:64454034-64454056 ATGGAGTAGAAATTCCTGGCAGG + Intergenic
1083912056 11:65715772-65715794 AATAAAAAGCAATTTCTGGCTGG + Intronic
1084217540 11:67658107-67658129 GAAATGCTGAAATTTCTGGCCGG + Intergenic
1084363083 11:68681733-68681755 AAGAAAAATAAATTTCAGGCCGG - Intergenic
1084903934 11:72331535-72331557 AAGAAGTAGAGACTTGTGGCTGG - Intronic
1086889759 11:92244228-92244250 AAGAAGCACAAAGTTCAGCCAGG - Intergenic
1087250065 11:95889056-95889078 AAGAAGTAGATACTTCAGGCAGG - Intronic
1087406810 11:97741027-97741049 CAGAAAGAGATATTTCTGGCTGG + Intergenic
1087425714 11:97982786-97982808 CAGCTGCAGAGATTTCTGGCTGG + Intergenic
1087607281 11:100392242-100392264 AAGAGGCACAAATTTCTTGCAGG - Intergenic
1088546180 11:110961566-110961588 ACAAAAAAGAAATTTCTGGCTGG + Intergenic
1089231102 11:116977444-116977466 AAAAAGCAGAGATTTTTGGGAGG - Intronic
1089332263 11:117698064-117698086 AAAAAGAAGGAAATTCTGGCTGG - Intronic
1090419989 11:126568067-126568089 AAGAAACAGAAATTAATGGCAGG + Intronic
1090518087 11:127449933-127449955 AAGAAGGTGAGATTTTTGGCAGG - Intergenic
1091100029 11:132863478-132863500 AAGAAGCAAAAGTTTCTCGCTGG + Intronic
1092797143 12:12123317-12123339 TAGAAGAAGAAACTTGTGGCAGG + Intronic
1094698323 12:32843275-32843297 AAGAAGTAGGAATGGCTGGCCGG - Exonic
1095688301 12:45060621-45060643 TAGAAGGATAAATTTCTCGCTGG + Intergenic
1096241575 12:49962634-49962656 AGGAGGCAGAAGTTTCTGGCAGG - Intronic
1096988090 12:55775181-55775203 AAGAAATAGAAATGTGTGGCTGG - Intronic
1097307273 12:58083346-58083368 ATGAGAGAGAAATTTCTGGCTGG - Intergenic
1097645608 12:62233044-62233066 GAGATGCAGAAATTGCTGGGAGG - Intronic
1097742162 12:63255997-63256019 AGAAAGAAGAAAATTCTGGCCGG + Intergenic
1098846768 12:75546963-75546985 AAAAAGAAGTAATTTTTGGCTGG + Intergenic
1098930334 12:76405160-76405182 AACAAGGAGAAATCTGTGGCCGG + Intronic
1099472296 12:83066332-83066354 AACAAGGAGAGAATTCTGGCAGG + Intronic
1100670956 12:96812329-96812351 ATGAAGCAGAGACTTCTGACTGG - Intronic
1100837844 12:98584155-98584177 AAGAAAAAGAAATATCTGGCCGG - Intergenic
1101286776 12:103322021-103322043 AAGAAAAAAAAATTTCTGGTTGG + Intronic
1101496043 12:105255237-105255259 CAGAAGCAGAGATTTCTGTGGGG - Intronic
1103447424 12:121003320-121003342 AAGAAGTAGAAGCTTGTGGCCGG - Intronic
1103876367 12:124130594-124130616 AATAAGAAGCAAATTCTGGCCGG - Intronic
1105058596 12:133127259-133127281 AGGAATAAGAAGTTTCTGGCCGG - Intronic
1106343057 13:28849719-28849741 GAGAAGCAGGAAAGTCTGGCTGG - Intronic
1107033215 13:35874592-35874614 AAAAAACAGAAATATCTTGCAGG - Intronic
1108587414 13:51882844-51882866 CAGCTGCAGACATTTCTGGCTGG - Intergenic
1108915616 13:55606542-55606564 CAGCTGCAGGAATTTCTGGCTGG + Intergenic
1109875449 13:68397480-68397502 AAGAAACAAAAAATACTGGCCGG + Intergenic
1110719282 13:78743537-78743559 AAGAATCAGAATTTTCTAGAAGG + Intergenic
1110857061 13:80308468-80308490 AAAAAGCAGGAGTTTCTGGCCGG - Intergenic
1111169840 13:84512122-84512144 AAGAAGTAAAAATTTCTGGCAGG - Intergenic
1111406053 13:87808621-87808643 AAAAAGTAAAAATTTCTGGTAGG + Intergenic
1111638240 13:90932738-90932760 AAGAAAAAGAACCTTCTGGCCGG - Intergenic
1111995057 13:95157772-95157794 TAGAAACAGAAACTTCAGGCCGG + Intronic
1112934793 13:104783870-104783892 AAAAAAAAGAATTTTCTGGCTGG - Intergenic
1113075544 13:106464501-106464523 ATGAAACAGAAACTTTTGGCTGG + Intergenic
1113315253 13:109173023-109173045 TAGAAGCAGGAATATCTGGGTGG + Intronic
1113611605 13:111649827-111649849 AAGAAGCACAGGTTTGTGGCGGG + Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1115012029 14:28559823-28559845 CAGCTGCAGAGATTTCTGGCTGG + Intergenic
1115341610 14:32298689-32298711 AAGAAGCAGCAGTTTGGGGCTGG + Intergenic
1116819666 14:49615661-49615683 AAAAAGTAGCAATTTTTGGCCGG - Intergenic
1116874933 14:50101711-50101733 AAAAAACAGTAATTTGTGGCTGG + Intergenic
1116899624 14:50349472-50349494 AAGCAGCAGGAGTTTCTGGGAGG + Intronic
1117361095 14:54974886-54974908 AAAAAGCAAAACTTGCTGGCTGG - Intronic
1117531355 14:56663368-56663390 AAGAATTATATATTTCTGGCCGG + Intronic
1118356627 14:65019188-65019210 AAAAAGAAGAACTTTCTGGCTGG + Intronic
1118771973 14:68948277-68948299 AAGAAGTAGGGTTTTCTGGCTGG + Intronic
1119000181 14:70874487-70874509 AAGAAACATAAAAATCTGGCTGG - Intergenic
1119562952 14:75605452-75605474 AGAAAGCAGAAGTGTCTGGCTGG - Intronic
1119848074 14:77845826-77845848 GAGAAGCAGGTATTTCTGACAGG - Intronic
1120241055 14:81950014-81950036 AACATGCAGAAATTCATGGCTGG - Intergenic
1121161119 14:91742044-91742066 AAAAAGAAGAAAATTCTGGCAGG + Intronic
1121225692 14:92320321-92320343 AAGCAGCAGAAATTTGTTTCCGG - Intergenic
1121591136 14:95110868-95110890 TAGAAGCACAAATATCTGTCAGG - Intronic
1122464815 14:101924735-101924757 AAGAAGCAGAAATTTCTGGCTGG - Intronic
1123702361 15:22924773-22924795 AAAAATCAGAAAATTTTGGCTGG + Intronic
1124996974 15:34732851-34732873 TAGAATCAGAGATGTCTGGCAGG - Intergenic
1125736686 15:41931969-41931991 AAAAAAAAGAAATTGCTGGCTGG - Intronic
1125884113 15:43215680-43215702 AAGAAAAAGAAAATTCTGGATGG - Intronic
1125978490 15:43977753-43977775 AAGAAACAGCATTTTCTTGCAGG + Intronic
1126016717 15:44358858-44358880 AAGATTTAGAAACTTCTGGCCGG + Intronic
1126656121 15:50979804-50979826 AATGAACAGAAATTTATGGCCGG - Intronic
1126777186 15:52110727-52110749 AAGGAGCTGAAATTCTTGGCTGG - Intronic
1126797087 15:52268266-52268288 AAGACGTAGAAATGGCTGGCCGG + Intronic
1126820087 15:52494284-52494306 TATAAGATGAAATTTCTGGCTGG + Intronic
1126915673 15:53463675-53463697 CAGAGGCAGGAATTTCTGGTTGG - Intergenic
1127480977 15:59376835-59376857 AATAAGAATAAATATCTGGCTGG - Intronic
1127939302 15:63677844-63677866 ATGAAGCAGAAATTACTATCAGG - Exonic
1128417396 15:67459168-67459190 AAGAACCAGAGATTTCAGACAGG - Intronic
1129919641 15:79309536-79309558 AACAAAAAGAAATTTCGGGCTGG - Intergenic
1131016682 15:89063262-89063284 AAGAAGCAGCAATTTTTGGCCGG - Intergenic
1131485515 15:92816844-92816866 AAGAAGGAGAAACTCCTGGAAGG - Intergenic
1132017084 15:98327693-98327715 TAGAAGCACAGTTTTCTGGCTGG + Intergenic
1132124488 15:99210726-99210748 TAGATGTAGAAATTTCTGACTGG + Intronic
1135071343 16:19354637-19354659 AAGCTGCAGAAATATGTGGCAGG + Intergenic
1135546054 16:23367592-23367614 ATGAAAAAGAACTTTCTGGCCGG - Intronic
1135571033 16:23549467-23549489 CAGCTGCAGAGATTTCTGGCTGG + Intronic
1137089122 16:36166395-36166417 AAAAATTAAAAATTTCTGGCAGG + Intergenic
1137358250 16:47787400-47787422 AAGAAGCAGATATTTATGGAGGG + Intergenic
1137638676 16:50009504-50009526 CAGAAGCAGAAATATATGGTTGG + Intergenic
1138705152 16:58908071-58908093 AACAGGCAGAGATTTCTGGGTGG + Intergenic
1138874240 16:60929502-60929524 AAGGTGCAGAAATATCTGCCAGG + Intergenic
1139167638 16:64587125-64587147 CAGAAGCAAACATTTGTGGCAGG - Intergenic
1139989776 16:70930629-70930651 AAGCAGCCTAAATCTCTGGCTGG + Intronic
1140062354 16:71581839-71581861 AAGCAGCACAAAATTTTGGCGGG + Intergenic
1140136270 16:72208337-72208359 AAGAAGCAGAAAAATCTGAATGG + Intergenic
1141571350 16:84935699-84935721 AAGAAGTAGAAACTCCTGGCCGG + Intergenic
1143294935 17:5863920-5863942 ATGGAGCAGAAATCCCTGGCTGG - Intronic
1143846455 17:9775903-9775925 AAGAAGAGGAAATTTGGGGCCGG + Intronic
1145078551 17:19875442-19875464 AAGAGAGAGAAATTTTTGGCCGG - Intergenic
1145283246 17:21483757-21483779 AAAAAGTACAAACTTCTGGCTGG + Intergenic
1145394236 17:22482043-22482065 AAAAAGTACAAACTTCTGGCTGG - Intergenic
1145825782 17:27876342-27876364 AAGCCTCAAAAATTTCTGGCTGG - Intronic
1146204583 17:30891666-30891688 AAGAAACAGTAATTTCAGCCGGG - Intronic
1146523463 17:33545679-33545701 AAGGAGAAGAAATTTCTAGAAGG - Intronic
1146732580 17:35207155-35207177 AAAAAGAAGGAAATTCTGGCTGG + Intergenic
1146819467 17:35973290-35973312 AACCATCAGAAGTTTCTGGCAGG + Intergenic
1148148016 17:45378207-45378229 AGAAATTAGAAATTTCTGGCTGG + Intergenic
1148161504 17:45452986-45453008 AAGCAGCAGAAATATTTGGAAGG + Intronic
1149272628 17:54997358-54997380 TAGAAGCTGCATTTTCTGGCAGG - Intronic
1150122234 17:62613827-62613849 AAGAAATAGATATTTCAGGCCGG + Intronic
1150392741 17:64799631-64799653 AAGCAGCAGAAATATTTGGAAGG + Intergenic
1150515972 17:65809550-65809572 AAGCAGCAGGAATTTTTGGTAGG + Intronic
1150697568 17:67418978-67419000 AAGAAGCACAAAGTTCTCACAGG - Intronic
1150762909 17:67978591-67978613 AATAAACAAAAATTTCTGGCCGG - Intronic
1151349051 17:73520728-73520750 CAGAAGCAGAAGCTTCAGGCAGG + Intronic
1151795777 17:76344423-76344445 AAAATACAGAAATTGCTGGCTGG - Intronic
1151957946 17:77389737-77389759 AAGAGGAAGAATTTCCTGGCTGG - Intronic
1152428767 17:80235650-80235672 AAGAAGCAGGAAAATATGGCTGG - Intronic
1153655683 18:7280133-7280155 AAGAAGCAGAAAGTTCAGGTAGG + Intergenic
1154362881 18:13678733-13678755 GAGAAGCACAGATTCCTGGCTGG - Intronic
1154408899 18:14124642-14124664 CAGCAGCAGAAATTGCTTGCTGG - Intronic
1155040186 18:22058764-22058786 AAGAAGAAGAAATTTAAAGCAGG + Intergenic
1155819325 18:30353828-30353850 CAGACACAGAAGTTTCTGGCTGG + Intergenic
1155881531 18:31155331-31155353 AAGAATTAGAAAATTTTGGCCGG + Intronic
1155933898 18:31735196-31735218 AAAAAGAAGGAATTCCTGGCTGG + Intergenic
1155950806 18:31911454-31911476 AAAAAAAAAAAATTTCTGGCCGG + Intronic
1155974800 18:32117197-32117219 AAAAAAAAAAAATTTCTGGCTGG - Intronic
1156096874 18:33544194-33544216 CTCAAGCAGAAATTTCTGGAAGG + Intergenic
1156278290 18:35606324-35606346 AAGAACCAGAAATGTTTGGTAGG + Intronic
1156287715 18:35715236-35715258 AAGATGCAGGGATTTTTGGCTGG - Intergenic
1156538901 18:37890769-37890791 AGGAAGCAGCACTTGCTGGCTGG + Intergenic
1157161244 18:45316180-45316202 AAGCTGCAGAAATTTCTGTGGGG - Intronic
1158485472 18:57862219-57862241 AAGAAGAAGAAAATAATGGCCGG - Intergenic
1159141114 18:64396193-64396215 AGGAAGTAGAAATTTAAGGCAGG - Intergenic
1159216010 18:65391370-65391392 TAGAAGCAGTTATTTCTGACAGG - Intergenic
1159429477 18:68332705-68332727 ATGAAAGGGAAATTTCTGGCAGG + Intergenic
1160225952 18:77010843-77010865 AAGAAATAGACATTTCTTGCAGG - Intronic
1160414324 18:78697485-78697507 AAGGAGCTGATATTTCAGGCTGG - Intergenic
1161255298 19:3305447-3305469 TAGAAGTAGGAATTACTGGCCGG + Intergenic
1161879886 19:6941370-6941392 AAGAAGAAGACATTTCTCTCTGG - Intergenic
1162920634 19:13900276-13900298 GAGAGGAAGAAAATTCTGGCAGG - Intronic
1163328975 19:16624002-16624024 GAGAAGCAGAACTCTCTGACAGG + Intronic
1163791576 19:19309481-19309503 AAAAAACAAAAATTACTGGCCGG + Intronic
1164163152 19:22643935-22643957 CTGTAGCAGAAATTGCTGGCAGG + Intronic
1164660008 19:29955910-29955932 AAGAGGCAGTAATTCCTGGCTGG + Intronic
1165506689 19:36236164-36236186 GAGAAGCAGAAAATTCATGCTGG + Exonic
1165586273 19:36918729-36918751 AAGAAGAAGAGTTCTCTGGCTGG - Intronic
1165704759 19:37967546-37967568 AAGAAGGGGAAATTTCCAGCCGG - Intronic
1165858090 19:38892097-38892119 AAGAAATATAAATTTCAGGCCGG + Intronic
1165912927 19:39240364-39240386 AAAAGGCAGAAAATTCTGGCCGG + Intergenic
1167340011 19:48909836-48909858 AAAAGGCAGAAATTTATGACTGG - Intronic
1168283536 19:55319407-55319429 AAGAAGATGAAATTACTGGCCGG - Intronic
1168436486 19:56321852-56321874 AATGGGGAGAAATTTCTGGCAGG + Intronic
925184384 2:1837000-1837022 TAGCAGCAGAAATTTGTGCCTGG + Intronic
925203384 2:1987154-1987176 AAGAATCAGAATTTTAGGGCTGG + Intronic
925626327 2:5845212-5845234 GAGAGCCAGAAATCTCTGGCTGG + Intergenic
925810541 2:7695836-7695858 AAGAAGAAGAAATTTCAGATAGG + Intergenic
926876623 2:17487406-17487428 AAGAAGTAGAACCTTCTGCCTGG + Intergenic
927031191 2:19122115-19122137 AAGAAGCTGAAATTTGTTTCTGG + Intergenic
927163196 2:20289518-20289540 AGGAAGCAAAAATATATGGCTGG + Intronic
927301469 2:21520761-21520783 AATAATCAGAACTTTTTGGCTGG - Intergenic
927418761 2:22907359-22907381 AAGAAGCAGAAAAATGTGTCAGG - Intergenic
929113698 2:38426522-38426544 AAGAAAAAGAAAATTCTGCCAGG + Intergenic
929828759 2:45330706-45330728 CAAAAGCAAACATTTCTGGCTGG - Intergenic
931952182 2:67376859-67376881 AAAAAGAAGAAACTTCCGGCTGG - Intergenic
932213848 2:69953452-69953474 AAGCAGCACAACTTTGTGGCCGG + Intergenic
932381140 2:71284391-71284413 AAGAAGCAATGAATTCTGGCTGG + Intronic
932689565 2:73900825-73900847 AAGAAGCTAAAAGTTCTGGAAGG - Intronic
932884806 2:75539977-75539999 GAGATGCAGACATTGCTGGCAGG + Intronic
933495583 2:83046534-83046556 AACAAGCTGGAAATTCTGGCAGG - Intergenic
933634846 2:84697693-84697715 AAGAAGTAGGAATTTCTGAGGGG + Exonic
934669460 2:96200873-96200895 AAGAAACAAAAATTGCTGGCTGG + Intronic
935393891 2:102585128-102585150 AATAACCAGAGATTTCAGGCAGG - Intergenic
935600935 2:104920631-104920653 AAGACTCAGAAATTGCAGGCTGG - Intergenic
937239078 2:120448794-120448816 AAGAAGCAGACATCTATAGCTGG + Intergenic
937327160 2:120996960-120996982 AATAAGAAAAAATATCTGGCTGG + Intergenic
937617249 2:123940724-123940746 AAGCATTAGAAATTTCTGGAAGG + Intergenic
937853172 2:126654369-126654391 AAGAAGCAGAAAGTTCTGCCAGG - Intergenic
937930068 2:127197677-127197699 AAGATAATGAAATTTCTGGCTGG - Intronic
938659615 2:133472172-133472194 AACAAGCAGAATTTTAGGGCAGG - Intronic
938971899 2:136440249-136440271 GAGAAGGAGAGATTTTTGGCAGG + Intergenic
939849887 2:147291938-147291960 CAGAAACAGAATTTTCTGGTAGG + Intergenic
940122910 2:150287586-150287608 AAGAAACAGAAGTTCATGGCTGG - Intergenic
940139934 2:150482930-150482952 AAGAAGCAGACAGTTCAGGTGGG - Intronic
942972460 2:181972898-181972920 AAGAACATGAAATTTCTAGCAGG - Intronic
943049139 2:182894394-182894416 CAGCTGCAGAGATTTCTGGCTGG + Intergenic
943151689 2:184121932-184121954 AAGAAGTAGAAATTTTTGTTGGG + Intergenic
943651809 2:190465694-190465716 AAAAAACAGAAGTTTATGGCCGG + Intronic
944007843 2:194932728-194932750 ATGTAGCAGAATTTTATGGCTGG - Intergenic
944173823 2:196807499-196807521 CAGAAGCAGTAAGTTCTGACTGG + Exonic
944297651 2:198085196-198085218 AAGAAGCTGAAATGTCTCGAAGG + Exonic
944465618 2:199996946-199996968 CAGATGCAGAAATTCCAGGCTGG + Intronic
945930482 2:215849997-215850019 AAGAAGCACAGATTACTGGAAGG - Intergenic
947062451 2:226181900-226181922 AACAAGGAGAAACTCCTGGCTGG - Intergenic
1168898741 20:1342046-1342068 AAGGAGCAGAAGTTCCAGGCAGG - Intronic
1169709530 20:8546018-8546040 AAGAAACTGAAATTCTTGGCTGG + Intronic
1169754501 20:9029437-9029459 AAGACGTATAATTTTCTGGCCGG + Intergenic
1170341484 20:15332873-15332895 ATGGAGGAGAAATTACTGGCAGG + Intronic
1170642602 20:18168229-18168251 AAGAAATAGAAATTTTTGACTGG + Intronic
1171393270 20:24815080-24815102 AAGAGGCAGAAAGTTCAGGCAGG + Intergenic
1172396952 20:34614326-34614348 AATAAAAACAAATTTCTGGCTGG + Intronic
1172745198 20:37202007-37202029 GAGAAAAAGAAATTGCTGGCTGG + Intronic
1173142634 20:40497647-40497669 AAAATGCTGAATTTTCTGGCAGG - Intergenic
1173258825 20:41415193-41415215 AAGGAGCAGACACTTCAGGCGGG - Exonic
1173272452 20:41550095-41550117 AAAAAGAAGACATTACTGGCTGG - Intronic
1174230119 20:49039585-49039607 AAGAAGGAGAATTTAATGGCTGG + Intergenic
1174620373 20:51869740-51869762 AAGAAACAGAAAAAACTGGCTGG + Intergenic
1174694230 20:52541322-52541344 AAGAGGGAGAAACTTCAGGCAGG - Intergenic
1175737598 20:61398046-61398068 AAGAAGCTCACACTTCTGGCTGG - Intronic
1175876541 20:62232865-62232887 AAGAACCCCAAATCTCTGGCTGG + Intronic
1177695932 21:24570580-24570602 AAGAAACAGGAAATTCTTGCAGG - Intergenic
1177703204 21:24665278-24665300 AAGAAGAAGAATTTTCTCCCAGG + Intergenic
1177844526 21:26273066-26273088 AAGCACCAGGAATCTCTGGCTGG + Intergenic
1178404821 21:32315584-32315606 AAGAAAGATAAATTTCTGCCAGG - Intronic
1178497385 21:33098905-33098927 AAAATGCAAAAAATTCTGGCCGG + Intergenic
1178857180 21:36260009-36260031 AAGAACTAGAATTTTTTGGCCGG + Intronic
1178974924 21:37213290-37213312 AAAAAGAAGGAAATTCTGGCTGG - Intergenic
1182206588 22:28634213-28634235 AAGAAACAGAAATTTCTGGCCGG + Intronic
1184587036 22:45454864-45454886 AAGAAGCAGTATTTTCTTCCAGG + Intergenic
949354590 3:3165289-3165311 AAGCAGCAGCAAGTTCTGACAGG + Intronic
949914517 3:8948876-8948898 AAGCAGTAGAGATATCTGGCAGG - Intronic
950603952 3:14061179-14061201 AGGAAGCAGTAATTTCTTGATGG + Intronic
951267633 3:20588243-20588265 AAGAAGAGGAAATTTGAGGCCGG - Intergenic
951305596 3:21057022-21057044 AAGATAAAGCAATTTCTGGCTGG - Intergenic
952084536 3:29801737-29801759 AAAGAGCAGAAATTTCTAGAAGG - Intronic
952758490 3:36892970-36892992 CAGAAGCAGAAATGACTGGTGGG + Exonic
953449674 3:42995780-42995802 AGGGAGCAGAAATCTCTGGAAGG + Intronic
954044864 3:47920859-47920881 AAGAAGTAGAAAAATGTGGCTGG + Intronic
954865426 3:53725077-53725099 TAGAAGAGGAAATTTGTGGCTGG - Intronic
954912559 3:54121981-54122003 AAGAAGCAGAAATCTCAGAAAGG - Intergenic
954926140 3:54236637-54236659 AAGATGTAGAAAATTCTTGCCGG + Intronic
955226237 3:57062643-57062665 AACAAGCAGGAATATCTGGTGGG + Intronic
955281483 3:57598483-57598505 TAAAAGCAAAAACTTCTGGCCGG + Intergenic
955282142 3:57603611-57603633 AAAAAAAAAAAATTTCTGGCCGG - Intergenic
955479488 3:59374957-59374979 AAGGAGCAGAATTTTCTGAATGG + Intergenic
955481207 3:59392367-59392389 AGGAAGCAGAAGTTTCTTCCTGG - Intergenic
956154193 3:66276767-66276789 GAGAAGCAGAAATTTTTGTGAGG + Intronic
956459132 3:69454137-69454159 AAGAAGGAGGAATTTCTGAGTGG + Intronic
957541140 3:81570637-81570659 AGGAAGCAGAGATATCTGGGTGG + Intronic
958187810 3:90145716-90145738 AAACAGCAAAAATTTCTGGGAGG + Intergenic
958745157 3:98125393-98125415 AAGAAGCAAAATTTTCTAGTGGG + Intergenic
958779940 3:98528837-98528859 AAGAAGCAGTTATTTCTGCCAGG + Intronic
961276186 3:125728972-125728994 AAAAGGCAGACACTTCTGGCCGG + Intergenic
961279100 3:125751540-125751562 AAAAGGCAGACACTTCTGGCCGG + Intergenic
961364413 3:126390161-126390183 AAGTAGAAGAAATTGCTGGGGGG - Intergenic
961601735 3:128067618-128067640 TAGAAGCAAAACTTTCTGGAAGG + Intronic
961823141 3:129585477-129585499 GAGAAGGAGAAATTTCAGTCTGG + Intronic
961875305 3:130018067-130018089 AAAAAGCAGGCACTTCTGGCCGG - Intergenic
961904393 3:130247392-130247414 AAGAAGAATAAAGTTTTGGCTGG - Intergenic
962013829 3:131420449-131420471 AAGAAGAAATCATTTCTGGCAGG - Intergenic
962051916 3:131825199-131825221 AAAAAGTGGTAATTTCTGGCCGG + Intronic
962619003 3:137158164-137158186 AAGCAGCATAATTTTATGGCGGG - Intergenic
963252187 3:143113872-143113894 TACAATCAAAAATTTCTGGCTGG - Intergenic
963346988 3:144106636-144106658 AAGAATCAGCAATTTCTTCCAGG + Intergenic
964185328 3:153935604-153935626 AATAAGCAGACTTTTCTTGCAGG + Intergenic
964292742 3:155199587-155199609 AAGAAGGGGAAATTTGAGGCCGG + Intergenic
964636791 3:158866682-158866704 TAGAATCAGAATCTTCTGGCCGG + Intergenic
965031625 3:163376602-163376624 GAGAAGCAGAAAGAGCTGGCTGG + Intergenic
965432097 3:168601650-168601672 AAAAAGCAAAGATTTCTGGAAGG - Intergenic
965464235 3:169006932-169006954 AAAAAGAAGAAATTCCTGGATGG + Intergenic
966126997 3:176590121-176590143 AAGCAGCAGAAAATACTGGAAGG - Intergenic
966161776 3:176976135-176976157 AACAAACAGAAATTTTTGGCCGG + Intergenic
966174820 3:177126552-177126574 AATAAGCAGTTATTTCTAGCTGG - Intronic
966530435 3:180972661-180972683 AAGAGGCAAAAATTTCTGTATGG + Intronic
966553842 3:181235654-181235676 AGGAAGCAAAAACTTCAGGCAGG - Intergenic
967248813 3:187516069-187516091 AAGACTCAGAAATTTGAGGCAGG + Intergenic
968065526 3:195756955-195756977 AAGAAAGAGAACTTTCTGGCCGG - Intronic
968166313 3:196467933-196467955 ATGTAGGAGAAATTTTTGGCTGG - Intergenic
969713218 4:8856315-8856337 TAGAAGCAGAAAGAGCTGGCGGG + Intronic
969794601 4:9517354-9517376 AAAAGGCAGGCATTTCTGGCCGG + Intergenic
969873228 4:10117186-10117208 AAGACGCTGAAAGTACTGGCGGG + Intergenic
971058286 4:22938155-22938177 AAGAAGCATAAATTTCTACTAGG - Intergenic
971069485 4:23074991-23075013 AGGAAACAGAAATTTGTGTCAGG + Intergenic
972259468 4:37393788-37393810 AAGAAGCAGAAAGTTCTGAGAGG - Intronic
972474238 4:39435412-39435434 AAGAAAAAAAAATTTCAGGCTGG - Intronic
972623961 4:40777860-40777882 AAGTAGCTGAAATTACAGGCAGG + Intronic
972911880 4:43827086-43827108 AAGAAACCGAAATTTCAGACTGG - Intergenic
973171855 4:47155154-47155176 AAGCAGCAGGAATTACAGGCAGG + Intronic
973197471 4:47462562-47462584 TAGAGGAAGAAATTTTTGGCTGG + Intronic
973222732 4:47747288-47747310 AAGATGCAAAAATCTCTGGGAGG - Intronic
974321363 4:60354109-60354131 AAGAAATAGATATTTCAGGCTGG - Intergenic
975153938 4:71050196-71050218 AAAAAGAAGGAAATTCTGGCTGG + Intergenic
975197187 4:71539522-71539544 AAGGAGAAGAGGTTTCTGGCTGG - Intronic
975224565 4:71856757-71856779 AGGAAGCAGAAAATTCTTGATGG + Intergenic
975713576 4:77184300-77184322 GAGAAGCAGACATTTCTACCTGG + Intronic
976099748 4:81548827-81548849 AAGAATCAGAAATTTAGGACTGG - Intronic
976612506 4:87044589-87044611 AAGCAGTGGAAATTTGTGGCTGG + Intronic
978194754 4:105957793-105957815 AGGAAGAAGAGATTTTTGGCAGG + Intronic
978588543 4:110299525-110299547 TAGAGGCACAAATTTCTGACTGG + Intergenic
979503057 4:121461713-121461735 CAGGAGCAGAAATATCTGGAGGG + Intergenic
980031527 4:127837244-127837266 TAAAAGCAAAAATTTTTGGCCGG - Exonic
980967733 4:139539420-139539442 GAGAAGTTGAAGTTTCTGGCTGG - Intronic
981727189 4:147860995-147861017 CAGACACAGAGATTTCTGGCTGG - Intronic
981979686 4:150776153-150776175 AAGAAACAGTAATTCATGGCTGG + Intronic
983193860 4:164783225-164783247 AAAAAAAAGGAATTTCTGGCCGG + Intergenic
983337992 4:166420801-166420823 GGGAAGGAGAAATGTCTGGCTGG - Intergenic
983965503 4:173804598-173804620 AAGAAACAGAAGATGCTGGCAGG - Intergenic
984386628 4:179067970-179067992 AAGAATGAGACATTTCTTGCTGG + Intergenic
984413927 4:179433002-179433024 AAGGAGCAGACCTTTCTGCCAGG - Intergenic
984480155 4:180290322-180290344 AAGAAGAAGAAACTACTGGGTGG - Intergenic
985342341 4:188968356-188968378 AAAAAGGAGGAAATTCTGGCCGG - Intergenic
985508272 5:297310-297332 AAGAAGCATAAGTTTCTGCTAGG - Intronic
985739768 5:1608360-1608382 AAGAAGCATAAGTTTCTGTTAGG + Intergenic
986237867 5:5928552-5928574 AATTAGCAGATATTTCTGGTTGG - Intergenic
986278960 5:6306794-6306816 AAGAAGAAGAATTTGCTGGAAGG - Intergenic
986318649 5:6609636-6609658 AAAAAGCAGAAATTTCTCATAGG - Intronic
987127569 5:14828888-14828910 CAGAAGAAGCAATTTCTGGCTGG + Intronic
987632604 5:20494335-20494357 AAGAAGCAGTAATGTCTGCAGGG + Intronic
988175236 5:27714752-27714774 AAGAAGCAGAAAATAATGGCAGG - Intergenic
988330922 5:29838792-29838814 AAAAAGAAGAAACTTCGGGCTGG + Intergenic
989172633 5:38487955-38487977 AAGATTCAGAAATTTGTGGGTGG - Intronic
989586003 5:43074314-43074336 AAGAAGCAGATACTGCTGACTGG + Intronic
989829940 5:45904072-45904094 AAGAAGAAGAAATTTCCCTCTGG + Intergenic
992027428 5:72684444-72684466 AGGAAGCAGAAATGTGAGGCAGG + Intergenic
992062511 5:73068712-73068734 TAGAAGAAGAACTTTCTGCCCGG - Exonic
992507056 5:77397324-77397346 AAGAAAAAGTAAGTTCTGGCTGG - Intronic
992858990 5:80892778-80892800 AAGAAGCAAAAATTTTGGTCAGG - Intergenic
993035319 5:82749755-82749777 AAGAACCAGATATTTCAGGAAGG + Intergenic
993467847 5:88269511-88269533 AAGAGGCAGAATTTTCTTCCTGG - Intergenic
994442502 5:99827904-99827926 AGGAAGCAGGAGTTCCTGGCAGG - Intergenic
995251365 5:109996921-109996943 AAGAAACAGAAATGTTTGTCAGG - Intergenic
997038962 5:130228965-130228987 TAGAAAAAGAAATTTCAGGCCGG + Intergenic
997054716 5:130428142-130428164 AAAAAGAAGCAATATCTGGCCGG + Intergenic
997167949 5:131682077-131682099 AAGAAACAAAAATTTCTGAAAGG - Intronic
998622182 5:143806958-143806980 AAGAAGCAGAAGCTGCAGGCTGG - Intergenic
998849315 5:146338736-146338758 AAGAATCGGAAAGGTCTGGCGGG + Intronic
998977902 5:147668424-147668446 AAGAAGCAGACAGATCTGGGTGG + Intronic
1000038641 5:157468209-157468231 AAAAATCTGACATTTCTGGCTGG - Intronic
1000116090 5:158154684-158154706 AAGAATTAGAGATGTCTGGCAGG - Intergenic
1000529790 5:162405337-162405359 AAGAAGCAGAAAATTATCTCTGG - Intergenic
1001707737 5:173753838-173753860 ACGCAGCACAAATTTCTGGTGGG + Intergenic
1002682219 5:180975520-180975542 AAGAAACAGATATTTCTGTTGGG + Intergenic
1005007296 6:21300908-21300930 AAGAAGAAGAAAATTCTGCTGGG + Intergenic
1005560822 6:27039220-27039242 AAGAAGCAGATGTTTCTGGTTGG + Intergenic
1005563843 6:27069229-27069251 AAGAAGCAGATGTTTCTGGATGG + Intergenic
1007680095 6:43628065-43628087 AAGAATCAGAAATTCTAGGCTGG + Intronic
1011308937 6:85959864-85959886 AAGAAGCAGAAACTTCTATATGG + Intergenic
1011824911 6:91294520-91294542 ATGAAGCAGGGATTTCTGGGAGG - Intergenic
1013087291 6:106867169-106867191 CAGCTGCAGAGATTTCTGGCTGG + Intergenic
1013258100 6:108410007-108410029 AAGAATCATACATTTTTGGCTGG + Intronic
1014226393 6:118852818-118852840 AAAAATCAGAAATTTCTGCTAGG - Intronic
1014592441 6:123290858-123290880 AAGAAAAAGTACTTTCTGGCTGG + Intronic
1015015052 6:128402546-128402568 TAAAAGCATTAATTTCTGGCTGG - Intronic
1015066739 6:129039193-129039215 AAGAAACAGAAAATTCTGTGTGG + Intronic
1016767145 6:147807397-147807419 AAACAACAGAAATTTATGGCTGG - Intergenic
1017509692 6:155103425-155103447 TAGAAGCAGGAATTAGTGGCCGG + Intronic
1018503337 6:164437254-164437276 TAGAAGCATAAATATCTGGGTGG + Intergenic
1021677021 7:23090598-23090620 AAGAAGCAAAATGTTTTGGCTGG + Intergenic
1022642681 7:32203210-32203232 AAGAAGAAGAAATATGTGGGAGG - Intronic
1023340790 7:39217308-39217330 TCGAAGGAGAAATTGCTGGCAGG + Intronic
1024096112 7:45983995-45984017 AAGAAGCTGAAAATTCTGGCAGG - Intergenic
1024617454 7:51127660-51127682 AAGAAGCTGAAAAGTCTGGGGGG + Intronic
1024623324 7:51182576-51182598 CAGAAGCAGAATTTTGTGGCCGG - Intronic
1025787576 7:64657700-64657722 AAAAAGCTGACATTACTGGCTGG + Intergenic
1026866899 7:73829655-73829677 AAGGGTCAGAAATTTCTGCCTGG - Exonic
1027485969 7:78762145-78762167 AACAAGTAGAGATTTTTGGCCGG + Intronic
1028334821 7:89638932-89638954 AAGAAGCAGAAACTTCAGGAAGG - Intergenic
1028337880 7:89679885-89679907 AAGAAGCAGTTATTTCAGGATGG + Intergenic
1028875075 7:95812897-95812919 AAGAATCAGAATTATCTGGATGG + Intronic
1029135831 7:98370496-98370518 AAAAAGCCAAAATTTCTGGGAGG - Intronic
1029958211 7:104661700-104661722 AGGAAGAAGAAATTTCTGCATGG - Intronic
1030682485 7:112448765-112448787 AGGAGGAAGAAACTTCTGGCTGG + Intronic
1030989487 7:116282613-116282635 AAGAAGCAGAAAGCTCAGGTGGG + Intergenic
1031757390 7:125662034-125662056 ATAAAGCACAAATTTCTGGTAGG - Intergenic
1031829698 7:126611499-126611521 ATGAGGAAGATATTTCTGGCTGG + Intronic
1032453273 7:132052830-132052852 GAGAAGCAGAACTTTCTAGTTGG + Intergenic
1032765440 7:134987067-134987089 AAGAAACTGAAGTTTCTGCCTGG - Intronic
1033063223 7:138127722-138127744 AACAAGTAGAAATTTGTGCCTGG + Intergenic
1033602314 7:142897068-142897090 AAGAGACAGAGATTTCTGCCTGG + Intergenic
1034076272 7:148234313-148234335 TAGAAGCAGATACCTCTGGCTGG + Intronic
1034658737 7:152750636-152750658 AAAAAGAAGCAATTCCTGGCCGG + Intergenic
1035089739 7:156298264-156298286 AAGAAACTGAAATTGCTGGTGGG + Intergenic
1036176492 8:6543111-6543133 AAGAAGCAGAAAGTCTTGGCTGG - Intronic
1036207968 8:6819189-6819211 AAGAAGCTGCAATTCCTGTCTGG - Intronic
1036544715 8:9756652-9756674 AAGAAATAGAAATATCTGGATGG - Intronic
1036662777 8:10718569-10718591 AAGAAAGAGGAATTGCTGGCCGG - Intergenic
1036776346 8:11615519-11615541 AAGGTGCAAATATTTCTGGCAGG - Intergenic
1036780283 8:11642222-11642244 AAGAAGCAGATATTTGAGGACGG - Intergenic
1037360934 8:18072926-18072948 AAGAATCAGGAATTTATGGCGGG - Intronic
1038208505 8:25492245-25492267 AAGAAAAATAACTTTCTGGCTGG - Intronic
1038258131 8:25969863-25969885 AAGAAACAGATATTGCTGTCAGG - Intronic
1038534672 8:28345270-28345292 AAGCAGCAGAAAATGCTGCCTGG + Intergenic
1038677053 8:29632615-29632637 AAGAAACAAAAACTTATGGCAGG + Intergenic
1039374216 8:37016850-37016872 AAAAAGAGGAAATTTCTGGTTGG - Intergenic
1039580736 8:38664694-38664716 AAGAGAAAGAAAATTCTGGCTGG + Intergenic
1040812285 8:51467631-51467653 AAGAAACAGAAAAGTCTGGTTGG + Intronic
1041267292 8:56077468-56077490 AAAAAGAAGGAAATTCTGGCCGG + Intergenic
1042361151 8:67884641-67884663 AACATGTAGAAATTTCTGGGTGG + Intergenic
1042739525 8:72027679-72027701 AAGTAGCACACATTTCTGACAGG - Intronic
1046458613 8:114504304-114504326 AAGAAGCGCAAAATTCTGGTGGG - Intergenic
1046517108 8:115276798-115276820 GAGAAGCAAGAATTTCTAGCAGG + Intergenic
1046551834 8:115727884-115727906 AAGAAGTAGAAATAAGTGGCTGG + Intronic
1046640374 8:116722669-116722691 AAGAAGCAGAGAAAACTGGCAGG + Intronic
1047775298 8:128065480-128065502 ATGAAGAAGAGACTTCTGGCTGG - Intergenic
1047903503 8:129448945-129448967 AAGAACCACAGATTCCTGGCCGG - Intergenic
1048078370 8:131098030-131098052 AAGAAGTAGAATTTCCTGGTAGG + Intergenic
1048104942 8:131397581-131397603 AAGAAGAAGTAACTTCTGCCTGG - Intergenic
1048207794 8:132429562-132429584 AAGAATGAGAGTTTTCTGGCTGG + Intronic
1048611520 8:136028312-136028334 AAGCAGCTGAACTTTCAGGCAGG + Intergenic
1048624037 8:136164762-136164784 AAGAAACATAAATTTCAGGGAGG + Intergenic
1049073049 8:140371997-140372019 AAGAAACAGAAGTTGTTGGCTGG - Intronic
1049521979 8:143096044-143096066 AAGAAGAAGAAATACCTGGCTGG - Intergenic
1050588111 9:7134079-7134101 AAGAACCAGAACTTCCTGGCAGG - Intergenic
1051569353 9:18538132-18538154 AAGAAGCAGAAATTCCAGCAGGG + Intronic
1051983989 9:23060208-23060230 AAGAAGCAATATTTTCTAGCAGG + Intergenic
1052937813 9:34107795-34107817 AGGAAGCAGTAAGTTCTGCCTGG + Intronic
1053160565 9:35810809-35810831 AAGAGGAAGGAATTTCTGGTGGG - Intronic
1053229881 9:36399597-36399619 AAAAAGATGAAATTTCTGACTGG - Intronic
1057372451 9:94486609-94486631 AAGAAGAGGAACTTCCTGGCTGG + Intergenic
1058142853 9:101376446-101376468 AAGAAGCATAATTTTCTAACTGG - Intronic
1059008993 9:110436021-110436043 AAGATGCAGAAATTTAAGGCTGG - Intronic
1060369368 9:123055526-123055548 AAGAAGAAGAAATATCTGGCTGG - Intronic
1061285008 9:129617400-129617422 AAGATGCTGAGATTTCAGGCAGG - Intronic
1061458645 9:130718019-130718041 AAAAAAAAGAAATTCCTGGCTGG + Intronic
1186359196 X:8821774-8821796 CAGAAGCAGAAAGGACTGGCTGG - Intergenic
1186461343 X:9750857-9750879 AAATAGCAGAAATGTATGGCCGG - Intronic
1186995288 X:15114907-15114929 AAGACGCAGGAATTGCTGGATGG + Intergenic
1187301234 X:18052187-18052209 AAGATTGAGAAATTTCTGGTTGG - Intergenic
1187334778 X:18372602-18372624 GTGAAGCAGAGATTTCTGCCTGG - Intergenic
1188282045 X:28282262-28282284 TAGAAGCATACAGTTCTGGCCGG + Intergenic
1189438497 X:41013547-41013569 AAAAAAAAGAATTTTCTGGCTGG + Intergenic
1189806473 X:44740234-44740256 AAGAAGAAGAAGTGTTTGGCAGG + Intergenic
1190488037 X:50949418-50949440 AAGAAGCAGAAATATAAGGCAGG - Intergenic
1190718797 X:53129383-53129405 AAGAAGAAGAAAAATCAGGCTGG - Intergenic
1191022140 X:55873277-55873299 AAAAAGCAAAAATGTCAGGCAGG - Intergenic
1191684627 X:63877611-63877633 AAACAGCAGAAATTGCTGGTTGG + Intergenic
1192094430 X:68195780-68195802 AAGTAGCAGAAAAGGCTGGCTGG - Intronic
1193460967 X:81790618-81790640 TAGAAGCACAACCTTCTGGCTGG - Intergenic
1194679830 X:96838934-96838956 TAGAAGCCAAATTTTCTGGCAGG - Intronic
1194814121 X:98421974-98421996 AACAAGAAGAAACTTCTGCCAGG - Intergenic
1195539914 X:106051922-106051944 AAGACGCATAAATTTCCAGCAGG + Intergenic
1195664715 X:107418564-107418586 AAAAAACAGACATTGCTGGCAGG + Intergenic
1195689249 X:107610311-107610333 CAGATGCAGAAATCTCCGGCTGG - Intergenic
1196428576 X:115598002-115598024 TATAAGAAGAAATTTTTGGCTGG + Intronic
1196783590 X:119403588-119403610 AGGAAGTAGAAATTTTTGACTGG - Intronic
1197440533 X:126483178-126483200 AAGAAGCAGAAATTCATTGTTGG + Intergenic
1197576478 X:128218362-128218384 AATACGGTGAAATTTCTGGCAGG + Intergenic
1197768541 X:130074448-130074470 AAGCAGCACAACTTTTTGGCTGG + Intronic
1198154003 X:133939943-133939965 AAGAAGCCTAAATCTTTGGCAGG + Intronic
1198255948 X:134924614-134924636 AAGATACAGAAAATGCTGGCTGG + Intergenic
1198982772 X:142418344-142418366 AAGAAGCAGAAAGTTCTTTATGG - Intergenic
1201897833 Y:19012495-19012517 TAGAAATAAAAATTTCTGGCCGG + Intergenic