ID: 1122464889

View in Genome Browser
Species Human (GRCh38)
Location 14:101925276-101925298
Sequence CCGGGGCGCCGCGTCGGGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 370}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122464877_1122464889 0 Left 1122464877 14:101925253-101925275 CCTCCCAGGACGGCCGCTAGCCT 0: 1
1: 0
2: 1
3: 2
4: 69
Right 1122464889 14:101925276-101925298 CCGGGGCGCCGCGTCGGGGCCGG 0: 1
1: 0
2: 5
3: 54
4: 370
1122464878_1122464889 -3 Left 1122464878 14:101925256-101925278 CCCAGGACGGCCGCTAGCCTCCG 0: 1
1: 0
2: 0
3: 6
4: 41
Right 1122464889 14:101925276-101925298 CCGGGGCGCCGCGTCGGGGCCGG 0: 1
1: 0
2: 5
3: 54
4: 370
1122464875_1122464889 12 Left 1122464875 14:101925241-101925263 CCGATGAGCTGGCCTCCCAGGAC 0: 1
1: 0
2: 2
3: 16
4: 178
Right 1122464889 14:101925276-101925298 CCGGGGCGCCGCGTCGGGGCCGG 0: 1
1: 0
2: 5
3: 54
4: 370
1122464879_1122464889 -4 Left 1122464879 14:101925257-101925279 CCAGGACGGCCGCTAGCCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1122464889 14:101925276-101925298 CCGGGGCGCCGCGTCGGGGCCGG 0: 1
1: 0
2: 5
3: 54
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122464889 Original CRISPR CCGGGGCGCCGCGTCGGGGC CGG Exonic