ID: 1122467049

View in Genome Browser
Species Human (GRCh38)
Location 14:101940925-101940947
Sequence CTTCTTATGGACCTTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122467049_1122467055 6 Left 1122467049 14:101940925-101940947 CCTGACACAAGGTCCATAAGAAG No data
Right 1122467055 14:101940954-101940976 TAGGAGAGGGTTCCTGTTTGTGG No data
1122467049_1122467060 20 Left 1122467049 14:101940925-101940947 CCTGACACAAGGTCCATAAGAAG No data
Right 1122467060 14:101940968-101940990 TGTTTGTGGAGGTATACTCGGGG No data
1122467049_1122467061 27 Left 1122467049 14:101940925-101940947 CCTGACACAAGGTCCATAAGAAG No data
Right 1122467061 14:101940975-101940997 GGAGGTATACTCGGGGAATCAGG No data
1122467049_1122467053 -8 Left 1122467049 14:101940925-101940947 CCTGACACAAGGTCCATAAGAAG No data
Right 1122467053 14:101940940-101940962 ATAAGAAGGTCAAGTAGGAGAGG No data
1122467049_1122467054 -7 Left 1122467049 14:101940925-101940947 CCTGACACAAGGTCCATAAGAAG No data
Right 1122467054 14:101940941-101940963 TAAGAAGGTCAAGTAGGAGAGGG No data
1122467049_1122467056 9 Left 1122467049 14:101940925-101940947 CCTGACACAAGGTCCATAAGAAG No data
Right 1122467056 14:101940957-101940979 GAGAGGGTTCCTGTTTGTGGAGG No data
1122467049_1122467062 28 Left 1122467049 14:101940925-101940947 CCTGACACAAGGTCCATAAGAAG No data
Right 1122467062 14:101940976-101940998 GAGGTATACTCGGGGAATCAGGG No data
1122467049_1122467058 18 Left 1122467049 14:101940925-101940947 CCTGACACAAGGTCCATAAGAAG No data
Right 1122467058 14:101940966-101940988 CCTGTTTGTGGAGGTATACTCGG No data
1122467049_1122467059 19 Left 1122467049 14:101940925-101940947 CCTGACACAAGGTCCATAAGAAG No data
Right 1122467059 14:101940967-101940989 CTGTTTGTGGAGGTATACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122467049 Original CRISPR CTTCTTATGGACCTTGTGTC AGG (reversed) Intergenic
No off target data available for this crispr