ID: 1122468076

View in Genome Browser
Species Human (GRCh38)
Location 14:101947999-101948021
Sequence CTCGGCTCCAGGTATCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122468076_1122468081 13 Left 1122468076 14:101947999-101948021 CCTCCAGGATACCTGGAGCCGAG No data
Right 1122468081 14:101948035-101948057 CGAGAAATGCCCCAATCTCAAGG No data
1122468076_1122468082 14 Left 1122468076 14:101947999-101948021 CCTCCAGGATACCTGGAGCCGAG No data
Right 1122468082 14:101948036-101948058 GAGAAATGCCCCAATCTCAAGGG No data
1122468076_1122468087 27 Left 1122468076 14:101947999-101948021 CCTCCAGGATACCTGGAGCCGAG No data
Right 1122468087 14:101948049-101948071 ATCTCAAGGGCGGCACCGAGAGG No data
1122468076_1122468083 17 Left 1122468076 14:101947999-101948021 CCTCCAGGATACCTGGAGCCGAG No data
Right 1122468083 14:101948039-101948061 AAATGCCCCAATCTCAAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122468076 Original CRISPR CTCGGCTCCAGGTATCCTGG AGG (reversed) Intergenic