ID: 1122470739

View in Genome Browser
Species Human (GRCh38)
Location 14:101964464-101964486
Sequence CTAAGGCCGCGAGCGAGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 30}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122470735_1122470739 1 Left 1122470735 14:101964440-101964462 CCGCGCACGCGCGGCGCCGTGAC 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1122470739 14:101964464-101964486 CTAAGGCCGCGAGCGAGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1122470732_1122470739 4 Left 1122470732 14:101964437-101964459 CCCCCGCGCACGCGCGGCGCCGT 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1122470739 14:101964464-101964486 CTAAGGCCGCGAGCGAGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1122470731_1122470739 5 Left 1122470731 14:101964436-101964458 CCCCCCGCGCACGCGCGGCGCCG 0: 1
1: 0
2: 10
3: 24
4: 274
Right 1122470739 14:101964464-101964486 CTAAGGCCGCGAGCGAGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1122470734_1122470739 2 Left 1122470734 14:101964439-101964461 CCCGCGCACGCGCGGCGCCGTGA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1122470739 14:101964464-101964486 CTAAGGCCGCGAGCGAGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1122470730_1122470739 8 Left 1122470730 14:101964433-101964455 CCGCCCCCCGCGCACGCGCGGCG 0: 1
1: 0
2: 6
3: 34
4: 316
Right 1122470739 14:101964464-101964486 CTAAGGCCGCGAGCGAGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1122470733_1122470739 3 Left 1122470733 14:101964438-101964460 CCCCGCGCACGCGCGGCGCCGTG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1122470739 14:101964464-101964486 CTAAGGCCGCGAGCGAGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1122470729_1122470739 9 Left 1122470729 14:101964432-101964454 CCCGCCCCCCGCGCACGCGCGGC 0: 1
1: 0
2: 9
3: 56
4: 402
Right 1122470739 14:101964464-101964486 CTAAGGCCGCGAGCGAGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1122470727_1122470739 14 Left 1122470727 14:101964427-101964449 CCGGGCCCGCCCCCCGCGCACGC 0: 1
1: 1
2: 12
3: 110
4: 824
Right 1122470739 14:101964464-101964486 CTAAGGCCGCGAGCGAGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122470739 Original CRISPR CTAAGGCCGCGAGCGAGCGC GGG Intergenic
915171062 1:153977510-153977532 CTAGGGCCGCGAGCCCCCGCCGG - Exonic
1073465602 10:103693088-103693110 TTAGGGCCGGGCGCGAGCGCGGG + Intronic
1090736882 11:129618147-129618169 CTGTGCCCGAGAGCGAGCGCGGG + Intergenic
1114254538 14:20990223-20990245 CTAAGGCGGCGAGCGCCTGCAGG - Exonic
1117875788 14:60249249-60249271 CTAGGGACGGGAGCGCGCGCGGG + Intronic
1118869132 14:69726930-69726952 CTGAGGCCGCAAGGGCGCGCCGG + Exonic
1122470739 14:101964464-101964486 CTAAGGCCGCGAGCGAGCGCGGG + Intergenic
1124129390 15:26971210-26971232 CTGGAGCCGCGAGCGGGCGCGGG - Intergenic
1133197849 16:4183805-4183827 CCAGGGACGCGAGCCAGCGCTGG + Intergenic
1144828698 17:18120426-18120448 CGAAGGCCGACAGCGCGCGCTGG - Exonic
1145748928 17:27341452-27341474 CTAAGGCCTAGAGCCAGCCCAGG - Intergenic
1151767966 17:76141656-76141678 CTAAGGCTGGGAGCGGGCTCAGG + Intergenic
1152398585 17:80050182-80050204 CAATGGCCTCGAGCGAGCGCAGG + Exonic
1157300659 18:46476760-46476782 CTAAGGCCGGGAGAGAAAGCAGG - Intergenic
1164958466 19:32406186-32406208 CCAAGACCGCGAGCGGCCGCCGG - Exonic
934119935 2:88828893-88828915 CTAAGGCCTCCAGTGAGGGCCGG + Intergenic
941220226 2:162769203-162769225 TTAAGGCCGCAAGAGAGCGGAGG - Intronic
946416850 2:219544062-219544084 CAAAGGCCGCGGGCGGGCTCAGG + Intronic
1176221031 20:63969525-63969547 CTGGGGCCGGGAGCGGGCGCGGG + Intronic
1179150575 21:38805643-38805665 CGGAGGCGGCGAGGGAGCGCGGG - Intronic
1184798619 22:46746796-46746818 CGAAGGCTCCCAGCGAGCGCAGG - Intergenic
964623815 3:158739898-158739920 CTAAGGCTGTGAGGGAGAGCAGG + Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
990376561 5:55176532-55176554 CTAGGGGCGGGAGCGGGCGCGGG - Intergenic
997472837 5:134126266-134126288 CAAAGGCTGCCAGCGAGCTCTGG - Intronic
1001382261 5:171312395-171312417 CGAAGGCCGCGGGCCAGCGCCGG + Intergenic
1003092779 6:3118431-3118453 CTGAGGCGACGAGCGAGGGCGGG + Intronic
1005802350 6:29440198-29440220 CCAAGGCCGAGAGGGTGCGCAGG - Exonic
1020125228 7:5529734-5529756 CTTAGGCCGCCAGGGGGCGCCGG + Intronic
1034223033 7:149460281-149460303 CGACGGCCGCGCGCGAGCCCCGG - Intronic
1037297183 8:17413454-17413476 CTAGGGCCGCGCGGGAGCCCCGG - Intronic
1061450230 9:130663708-130663730 CTAGGGCTGCGCGCGAGCTCGGG + Intergenic
1203776138 EBV:74251-74273 CGAGGGGCGTGAGCGAGCGCAGG + Intergenic