ID: 1122471818

View in Genome Browser
Species Human (GRCh38)
Location 14:101973330-101973352
Sequence TTTAATTTTTAGTAGGTATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20884
Summary {0: 1, 1: 1, 2: 71, 3: 1422, 4: 19389}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122471811_1122471818 2 Left 1122471811 14:101973305-101973327 CCAACCACCACACCCAGCTAATT 0: 2908
1: 15366
2: 41229
3: 70254
4: 76402
Right 1122471818 14:101973330-101973352 TTTAATTTTTAGTAGGTATAGGG 0: 1
1: 1
2: 71
3: 1422
4: 19389
1122471809_1122471818 26 Left 1122471809 14:101973281-101973303 CCCAAATAACTGAAATTACAGGT 0: 2
1: 8
2: 420
3: 7099
4: 60826
Right 1122471818 14:101973330-101973352 TTTAATTTTTAGTAGGTATAGGG 0: 1
1: 1
2: 71
3: 1422
4: 19389
1122471810_1122471818 25 Left 1122471810 14:101973282-101973304 CCAAATAACTGAAATTACAGGTG 0: 2
1: 14
2: 523
3: 8514
4: 62791
Right 1122471818 14:101973330-101973352 TTTAATTTTTAGTAGGTATAGGG 0: 1
1: 1
2: 71
3: 1422
4: 19389
1122471807_1122471818 29 Left 1122471807 14:101973278-101973300 CCTCCCAAATAACTGAAATTACA 0: 2
1: 37
2: 1110
3: 17380
4: 138822
Right 1122471818 14:101973330-101973352 TTTAATTTTTAGTAGGTATAGGG 0: 1
1: 1
2: 71
3: 1422
4: 19389
1122471814_1122471818 -10 Left 1122471814 14:101973317-101973339 CCCAGCTAATTTTTTTAATTTTT 0: 118
1: 2087
2: 44329
3: 203355
4: 253938
Right 1122471818 14:101973330-101973352 TTTAATTTTTAGTAGGTATAGGG 0: 1
1: 1
2: 71
3: 1422
4: 19389
1122471813_1122471818 -5 Left 1122471813 14:101973312-101973334 CCACACCCAGCTAATTTTTTTAA 0: 90
1: 1298
2: 32723
3: 87884
4: 175979
Right 1122471818 14:101973330-101973352 TTTAATTTTTAGTAGGTATAGGG 0: 1
1: 1
2: 71
3: 1422
4: 19389
1122471812_1122471818 -2 Left 1122471812 14:101973309-101973331 CCACCACACCCAGCTAATTTTTT 0: 8934
1: 53417
2: 125104
3: 192980
4: 185786
Right 1122471818 14:101973330-101973352 TTTAATTTTTAGTAGGTATAGGG 0: 1
1: 1
2: 71
3: 1422
4: 19389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122471818 Original CRISPR TTTAATTTTTAGTAGGTATA GGG Intronic
Too many off-targets to display for this crispr