ID: 1122472473

View in Genome Browser
Species Human (GRCh38)
Location 14:101980007-101980029
Sequence ATGTTACTCTTTAATATCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 318}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122472471_1122472473 25 Left 1122472471 14:101979959-101979981 CCGAGAAATTCAAAAAGTAAGAG 0: 1
1: 0
2: 2
3: 43
4: 507
Right 1122472473 14:101980007-101980029 ATGTTACTCTTTAATATCTTTGG 0: 1
1: 0
2: 2
3: 28
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122472473 Original CRISPR ATGTTACTCTTTAATATCTT TGG Intronic
900885676 1:5413738-5413760 ATGTTACTCCTCAGCATCTTGGG + Intergenic
907149863 1:52274077-52274099 TTCTTAATCTTTAATACCTTGGG - Intronic
907164970 1:52402492-52402514 ATGTTACAGTTTCATTTCTTAGG - Intronic
908035152 1:60043671-60043693 ATTTCACTCTTTAAAATATTTGG + Intronic
908908430 1:69043300-69043322 ATTTTATTCTTTAATTTCTGTGG - Intergenic
910032841 1:82751964-82751986 ATGTTACTCTCAAACATTTTAGG + Intergenic
910223220 1:84910462-84910484 ATGCTACTCTTCAATAACATAGG - Intergenic
910519133 1:88098129-88098151 TTATTACTCTATAATTTCTTAGG + Intergenic
910950168 1:92637734-92637756 TTTTTACTCTTTAATATGTTAGG + Intronic
913244221 1:116857469-116857491 AAGTTATTATTTAATGTCTTTGG + Intergenic
914782487 1:150798231-150798253 ATGTTTCTCTTCACAATCTTTGG + Intronic
915403645 1:155642766-155642788 ATGTTAATAATTAATATCCTGGG - Intergenic
916150722 1:161786314-161786336 CTTTTTCTCTTTAATATTTTAGG + Intronic
916449890 1:164910554-164910576 TTGTCACTATATAATATCTTTGG - Intergenic
918509381 1:185293707-185293729 ATGGAATTCTTTAATATCTTTGG + Intergenic
918729719 1:187976497-187976519 GTGTTACTCTTAAATGTCTCTGG - Intergenic
919392070 1:196998461-196998483 ATGTTATTCTTTAAAAGCCTTGG + Intronic
920392410 1:205616830-205616852 ATGTTAATATTTAATATGTTAGG - Intronic
920761906 1:208792197-208792219 ATTTTAGACTTCAATATCTTTGG - Intergenic
920995724 1:210988715-210988737 ATGTTTCTGTTTAATATGTGAGG + Intronic
921567329 1:216736100-216736122 AGGTTACTCATTAATACCCTAGG - Intronic
921632528 1:217453255-217453277 ATATTGTTCTTTAATAACTTTGG - Intronic
924079459 1:240378847-240378869 ATGTTTTTCTTTAATATTTGAGG + Intronic
924292962 1:242556804-242556826 ATTTTACTCTCTAATATATCAGG - Intergenic
1064303332 10:14142460-14142482 CTGTTTCTCTTAAATCTCTTAGG - Intronic
1064707935 10:18092137-18092159 ATGTTCCTCATAACTATCTTAGG - Intergenic
1065990110 10:31000719-31000741 ATGTTACAATTTAAAATCTGGGG + Intronic
1068174209 10:53436782-53436804 ATTTTTTTCTTTAAGATCTTAGG + Intergenic
1068298919 10:55113369-55113391 ATGTTAATTTTTAAGAGCTTAGG + Intronic
1068482696 10:57613729-57613751 ATATTACTCTTTAGTATAGTGGG + Intergenic
1068561067 10:58514052-58514074 TTTTAACTCTTTAATTTCTTTGG + Intronic
1071095178 10:81964982-81965004 ATGTTACATTTTAATATGTTTGG - Intronic
1071691499 10:87824923-87824945 ACGTTAAACTTTATTATCTTTGG - Intronic
1071887096 10:89963221-89963243 ATTTTACAATTTAATATCTGAGG + Intergenic
1071889374 10:89985994-89986016 ATATTATTCTTTAATATTTTTGG - Intergenic
1072310704 10:94151406-94151428 TTGTTATTCTTTCATGTCTTGGG - Intronic
1073257478 10:102162392-102162414 ATGTTACACTGTAAAGTCTTAGG - Exonic
1073455394 10:103633812-103633834 AAGTTGCTATTAAATATCTTAGG + Intronic
1074423183 10:113327514-113327536 ATTTTACTCTTTGAGGTCTTTGG - Intergenic
1078237021 11:9494805-9494827 ATCTTAGTATTTAATATCCTAGG - Intronic
1078324882 11:10371388-10371410 ATGTTCTCCTTTAATAACTTAGG - Intronic
1078457813 11:11489002-11489024 ATGTTGCTCCTTAATTTCTATGG - Intronic
1078970716 11:16407812-16407834 AGTTTCCTTTTTAATATCTTTGG - Intronic
1079040916 11:17058788-17058810 ATATTACTCGTTAATATTCTAGG - Intergenic
1079842037 11:25415098-25415120 TTGTTATACTTTAAGATCTTGGG - Intergenic
1080273581 11:30477654-30477676 ATGTTATTCTGTAATTTTTTTGG + Intronic
1080808963 11:35683207-35683229 ATTTTAGTCTTTAATCTCTGTGG - Intronic
1081461969 11:43280293-43280315 AGGTTACTCTTTAAACCCTTGGG - Intergenic
1082961755 11:58924518-58924540 ATGTTTCCCTTTAATATTTCTGG + Intronic
1083134555 11:60659742-60659764 ATGCTCCTCTTTCATATCTTGGG - Intergenic
1085184677 11:74565498-74565520 AAGGTGCTCTTTAATATCTGAGG - Intronic
1085432572 11:76466344-76466366 TTGTTACTCTTTACTGCCTTAGG + Intronic
1086073829 11:82828923-82828945 ATGTCACTCTTTAATCTTTTTGG + Intronic
1088224081 11:107599910-107599932 CTGTTGCTCTTTAATAGCTTTGG - Intronic
1089521170 11:119064787-119064809 ATGTAACTGTTTTATATCATGGG + Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1090929716 11:131284588-131284610 ATTTAATTCTTTAATATTTTGGG + Intergenic
1091891488 12:4058529-4058551 ATGTTACTCTTTCATAATTTAGG + Intergenic
1093671678 12:21883737-21883759 ATGAAACACTGTAATATCTTTGG - Intronic
1095325961 12:40893017-40893039 ATGTTTCTATTTAATATTTTTGG - Intronic
1096910148 12:54975163-54975185 ATGTTCCTGTTTTATATATTAGG + Intronic
1097785042 12:63749743-63749765 ATGTTACTTTTTAAATTCATAGG + Intergenic
1098512056 12:71328036-71328058 ATGTAACTCCTTTATGTCTTTGG - Intronic
1099284928 12:80705889-80705911 ATGTTAAGCTTTGATATTTTTGG - Intergenic
1099470421 12:83041267-83041289 ATGTCACTGTTTAAAATCTATGG - Intronic
1099540144 12:83897991-83898013 ATGTTACTCTTTAAAGTTTTGGG + Intergenic
1100678402 12:96893192-96893214 ATGTTAATCTCCAAGATCTTTGG + Intergenic
1101286909 12:103323814-103323836 GTATTTCTTTTTAATATCTTGGG - Intronic
1102843137 12:116147826-116147848 ATGTTACTCAATAATATTATGGG - Intronic
1104347694 12:128016751-128016773 ATGTTACTCTTTTTTCTTTTGGG - Intergenic
1104535002 12:129610420-129610442 AATTGACTCTTTAATATATTAGG - Intronic
1106476533 13:30103210-30103232 ATGTAACTCTTGAATAAATTTGG - Intergenic
1108571340 13:51754798-51754820 ATGATACTATTTAATAACCTGGG + Intronic
1108616057 13:52133425-52133447 TTGTTATTTTTTAATATATTAGG - Intronic
1108978253 13:56477286-56477308 ATCTTCCTCTTTAAAATATTTGG - Intergenic
1108980492 13:56506799-56506821 ATGTTACTCTATACTTTATTAGG + Intergenic
1109621140 13:64907012-64907034 ATTTTACTCTTTACTTTCTTCGG - Intergenic
1109888960 13:68581806-68581828 ATGCTACTATAAAATATCTTGGG + Intergenic
1109967633 13:69722036-69722058 TGGTTACATTTTAATATCTTAGG - Intronic
1110017660 13:70428416-70428438 ATGTTATTCTTTAGTTTGTTCGG - Intergenic
1110037762 13:70710541-70710563 ATTTTACTTTTTAATATGTCTGG + Intergenic
1110785640 13:79522484-79522506 ATTTTACTCTATTATATTTTGGG - Intronic
1111797973 13:92947570-92947592 AGCTTACTCTTTAATAATTTGGG + Intergenic
1112837876 13:103537927-103537949 ATTATTCTTTTTAATATCTTTGG + Intergenic
1112850981 13:103706401-103706423 GTGTGCCTCTTTAATATGTTTGG - Intergenic
1113141223 13:107152322-107152344 ATGTTTCTCTTCAATTTTTTTGG + Intergenic
1113652859 13:112048665-112048687 ATCTTTCTCTTTCAAATCTTCGG + Intergenic
1116742167 14:48770109-48770131 ATGTTAATCTTTCAGATTTTTGG - Intergenic
1117030778 14:51667703-51667725 ATATTACACTTGAAAATCTTGGG - Intronic
1117452799 14:55867129-55867151 ATGTTGCTTTTTAAAATGTTTGG + Intergenic
1118225182 14:63892083-63892105 ATATTTCTTTTAAATATCTTGGG + Intronic
1120258030 14:82143872-82143894 ATGATACTGTTTAATATCAATGG + Intergenic
1120358976 14:83471645-83471667 ATGCTACTATTGAATCTCTTGGG + Intergenic
1120504998 14:85344702-85344724 ATGTCACTCTTGAAGATATTTGG + Intergenic
1121973833 14:98384028-98384050 ATTTTACTCGTTAATTTCATAGG - Intergenic
1122472473 14:101980007-101980029 ATGTTACTCTTTAATATCTTTGG + Intronic
1124406836 15:29400598-29400620 ATTTTACTCTTTGATTTCTCTGG - Intronic
1124868529 15:33517705-33517727 GTATAACTCTTTAATATCTCTGG + Intronic
1125562379 15:40645410-40645432 ATGAAACTTTTTAATATATTAGG - Intronic
1125898331 15:43321545-43321567 ATGCTACTCATTAAGAACTTTGG - Intergenic
1126132836 15:45359725-45359747 ATTTTTCTATTTAATATTTTTGG - Intergenic
1126971150 15:54113059-54113081 ATTTTACTCTTTATCATGTTAGG + Intronic
1129223725 15:74152578-74152600 ATGTTATTTTTTAATATGGTAGG - Intergenic
1130300515 15:82676933-82676955 ATGTTACTCTCCAGAATCTTTGG + Intronic
1131169743 15:90169117-90169139 ATGTTACTATTTAATTGTTTTGG - Intronic
1131726561 15:95232501-95232523 ATCTTCCTTTTTAATATCTAGGG - Intergenic
1134265274 16:12687274-12687296 ATGTTAATATTTATTATCTCTGG - Intronic
1138305325 16:55969292-55969314 CTGTAACTCTATAATACCTTTGG - Intergenic
1144118665 17:12127946-12127968 ATCTTCCTCTGTAATATGTTTGG + Intronic
1146387132 17:32387351-32387373 ATGTTACTTTTAAAAATCTAAGG + Intergenic
1146614862 17:34348145-34348167 ATGTTACTCTCTAAGATTGTGGG + Intergenic
1146701663 17:34966270-34966292 TTGTTACTATTAAAGATCTTAGG - Intronic
1148281532 17:46351927-46351949 TTATTACTTTTTAATATTTTTGG - Intronic
1148303758 17:46569866-46569888 TTATTACTTTTTAATATTTTTGG - Intronic
1148320297 17:46745217-46745239 ATGTATCACTTTAATATATTCGG + Intronic
1148626807 17:49075725-49075747 ATGTTAACCATTAATCTCTTTGG - Intergenic
1149172265 17:53824717-53824739 ATGTGACTTTTTAACATCCTTGG - Exonic
1149251190 17:54771498-54771520 ATTTTACTCTTCAATATTTTGGG + Intergenic
1150529761 17:65964781-65964803 ATGTTCCTCTTTAATTTTTGAGG + Intronic
1153088174 18:1313165-1313187 ATGTTTCTTTATAATCTCTTGGG - Intergenic
1154021400 18:10667154-10667176 ATATAACACTTTAATATTTTAGG + Intronic
1154021897 18:10670677-10670699 TTGTAACTCTTTAATAACTGAGG - Intronic
1154090215 18:11351588-11351610 GTGTTGCTGTTTAATTTCTTAGG - Intergenic
1155410959 18:25544161-25544183 ATCTTACTTTTGCATATCTTTGG + Intergenic
1155428448 18:25730084-25730106 ATGTTACATTTTAAAATCTGTGG - Intergenic
1155574808 18:27232711-27232733 AAGCTACTTTTTAATCTCTTAGG - Intergenic
1155728403 18:29118880-29118902 ATATTACTCTTGAATTTTTTAGG - Intergenic
1155776541 18:29769003-29769025 TGGTTACTCTTTAATTTCATAGG + Intergenic
1155796769 18:30048543-30048565 ATGTTAATGTTTAAATTCTTTGG + Intergenic
1156440322 18:37179846-37179868 ATGTTACTCTTGATTCTCTGTGG + Intronic
1157466465 18:47950871-47950893 TTTTTTCTCTTTAATATATTGGG - Intergenic
1158802988 18:60934841-60934863 ATGTTTCTCTGTAATAGATTTGG - Intergenic
1158929413 18:62308417-62308439 ATGTTACACTTAAAGAGCTTTGG + Intergenic
1159528446 18:69624901-69624923 ATGTTAATCTTCAAAATGTTTGG - Intronic
1159548643 18:69871849-69871871 ATCTTCCTGTTCAATATCTTTGG - Intronic
1159714919 18:71809782-71809804 TTGTTACTATTTAATCTGTTTGG + Intergenic
1160141994 18:76332908-76332930 ATTTTATTCTTTAATAGCTATGG - Intergenic
1162233996 19:9291386-9291408 ATGTTGCTTTGTAATATTTTTGG - Intergenic
1165005296 19:32800599-32800621 ATGTGACTTTTTAATATTTTAGG - Intronic
1166575345 19:43832092-43832114 ATGTTAATCTTGAATATTTAGGG + Intronic
925831079 2:7896172-7896194 ATGCTTCTCTTTAATCTCTCAGG - Intergenic
926510027 2:13764071-13764093 ATGTAACTATTTAATAGCATAGG - Intergenic
926587496 2:14704196-14704218 ATATCACTAATTAATATCTTTGG - Intergenic
927218583 2:20685231-20685253 ATGTTACTCTTTATTCTGGTAGG + Exonic
927270346 2:21201672-21201694 ATGTTTCTTTTTAATATGGTAGG + Intergenic
927461534 2:23303127-23303149 ATATAACTTTTGAATATCTTGGG + Intergenic
930810245 2:55532923-55532945 AAGTTACTTTTTATTTTCTTGGG + Intronic
931490746 2:62743981-62744003 ATGTTCCTTTTTAATGGCTTTGG + Intronic
931604660 2:64040979-64041001 AGGTTATTTTTTAAAATCTTTGG + Intergenic
933562289 2:83903227-83903249 ATGATACTTTTGAATATTTTTGG + Intergenic
935877931 2:107532311-107532333 ATCTTACCCTTTAAAATATTAGG + Intergenic
937531471 2:122833397-122833419 ATGTTACTCATTCCTCTCTTAGG + Intergenic
939171524 2:138701689-138701711 ATGTTGCTTTTTAATATTTCAGG + Intronic
939474596 2:142671023-142671045 ATGTAACTCCCTAATTTCTTAGG + Intergenic
939701566 2:145399109-145399131 ATGTAAAACTTTTATATCTTTGG + Intergenic
939749918 2:146031450-146031472 ATTTTTCCCTTTAATATTTTAGG + Intergenic
939757646 2:146134136-146134158 ATCTGACCTTTTAATATCTTGGG - Intergenic
939955138 2:148521504-148521526 AAGTTAATCTTAAATAACTTTGG + Intergenic
940686482 2:156857293-156857315 TAGTTACTGTTTAATACCTTAGG + Intergenic
941145326 2:161836752-161836774 ATGATACTTTTTAATAATTTTGG - Intronic
941502859 2:166302058-166302080 ATATTACTTTTTATTATCTAAGG + Intronic
941595752 2:167475115-167475137 AATTTACTATTTAATATTTTTGG - Intergenic
942232873 2:173876221-173876243 ATATTACACTTTAAAATATTGGG - Intergenic
942662954 2:178285671-178285693 ATATAACTATTTGATATCTTAGG + Intronic
943118649 2:183706985-183707007 ATGTTTTTCTTTAATATCTTGGG - Intergenic
943148192 2:184073195-184073217 TTGTTACTCTTAATTAGCTTTGG + Intergenic
943172917 2:184427053-184427075 ATTTTACTATTAAATAACTTGGG - Intergenic
943394891 2:187322002-187322024 AGGCTCCTCTTTAGTATCTTTGG + Intergenic
943937012 2:193932586-193932608 ATGTTATTCTTTCAGAACTTTGG + Intergenic
945922127 2:215765674-215765696 ATGTTATTGGTTAATAGCTTTGG + Intergenic
946275840 2:218630915-218630937 ATCTTGCTCTTTAATGTCCTTGG + Intronic
946671453 2:222109330-222109352 ATGTTTCTCTGTAAACTCTTTGG - Intergenic
949028252 2:241776343-241776365 ATCTGACTTTTTAAAATCTTGGG - Intergenic
949057823 2:241938488-241938510 TTGTAAGTCTTTAACATCTTTGG + Intergenic
1169485180 20:6024343-6024365 ATGTTACTGTCTAATTGCTTTGG + Intronic
1170617027 20:17961966-17961988 ATGTGAATCTTTAATATTTGTGG - Intronic
1173881606 20:46417342-46417364 ATGTTACTGTTTCATGTGTTGGG - Intronic
1177032220 21:15995097-15995119 ATGTTTATCTTTAAAACCTTTGG + Intergenic
1177390750 21:20467969-20467991 ATGTTTATCTTTGATATCTGTGG + Intergenic
1178170445 21:30034264-30034286 ATGTTAGACTTAAATTTCTTAGG + Intergenic
1178946440 21:36952129-36952151 ATTTTTCTATTTAATACCTTAGG + Intronic
1182408716 22:30162518-30162540 ATGATAGTTTTTAATATATTGGG + Intronic
1183858798 22:40654083-40654105 GTGTTACCCTTAAACATCTTAGG - Intergenic
951407094 3:22314569-22314591 ATCTTATTCCTTAATATCCTGGG - Intronic
951631396 3:24725181-24725203 ATTTTTCTCTTTCATATTTTGGG + Intergenic
952082734 3:29780574-29780596 ATTTAACTCTTTAGTATATTTGG + Intronic
952880140 3:37980071-37980093 ATGTTACTTTTAAACATGTTTGG + Intronic
953153326 3:40344877-40344899 ATATTGTTCTGTAATATCTTAGG + Intergenic
955706025 3:61728689-61728711 ATCTTATTATTTTATATCTTAGG + Intronic
956977046 3:74593440-74593462 ATGTTACATTTTTATATTTTTGG - Intergenic
957327655 3:78717018-78717040 ATGATATTCTTTAATATCACAGG - Intronic
958107411 3:89094033-89094055 ATGTTGTTCTTAAATGTCTTTGG + Intergenic
958552418 3:95633949-95633971 ATATCAGTCTTTAATATATTTGG + Intergenic
958733591 3:97985334-97985356 ATAGTAATCCTTAATATCTTTGG - Intergenic
958739041 3:98045883-98045905 ATATTAATCTTTTATATTTTAGG + Intergenic
959545567 3:107591998-107592020 ATGTTATTTTTGAATATTTTTGG + Intronic
959965103 3:112345225-112345247 ATGTGTCTCTTCAATACCTTTGG + Exonic
960504885 3:118480148-118480170 AAGTTAGTGTTTTATATCTTTGG - Intergenic
961362230 3:126375380-126375402 ATGTGACTCTTTAAGGGCTTGGG - Intergenic
962182528 3:133223495-133223517 ATGTAACTCTGTACTTTCTTAGG + Intronic
963186309 3:142421260-142421282 ATGTTACTCTTTTATATATATGG + Intronic
963495086 3:146048134-146048156 ATGTTAATTTTTAATAGTTTAGG - Intergenic
963513021 3:146272955-146272977 GTGTTGATTTTTAATATCTTGGG - Intergenic
965468339 3:169060058-169060080 ATTTTTCTATTTAATATTTTGGG + Intergenic
966157744 3:176935412-176935434 AAATTACATTTTAATATCTTAGG - Intergenic
966403900 3:179575319-179575341 ATTTTACTATTGAATATCTCAGG + Intronic
970376733 4:15465878-15465900 ATGATACTTTTTAATATTTTTGG + Intergenic
971563225 4:28108202-28108224 ATGATAAACTGTAATATCTTTGG - Intergenic
973060964 4:45723748-45723770 TTGTTATTGTTTGATATCTTTGG - Intergenic
973173992 4:47181407-47181429 TTTTTACTCTTTAATCTGTTTGG + Intronic
974844794 4:67339209-67339231 ACGGAACTCTTTTATATCTTTGG - Intergenic
975265707 4:72364291-72364313 ATAATACTCTTTAAAATCTTTGG - Intronic
975457153 4:74605989-74606011 CTTTAACTCTTTAATATCTTGGG + Intergenic
975839990 4:78463748-78463770 ATGTTACTCTTCTTTTTCTTGGG - Intronic
975913908 4:79299864-79299886 ATGTGACTCTACAATATCTAAGG + Intronic
975947566 4:79726056-79726078 ATTTTACTAATTTATATCTTGGG - Intergenic
976657518 4:87504790-87504812 ATCTTACTCCTTAAAATGTTTGG - Intronic
977173654 4:93793323-93793345 ATGTTTTTCTTTAATCTCTTAGG - Intergenic
977477695 4:97534073-97534095 TTGTTACTTTTTAAAATTTTAGG + Intronic
977943476 4:102883080-102883102 TTATTATGCTTTAATATCTTAGG + Intronic
978419815 4:108519111-108519133 AAGTTAATTTTTAATTTCTTAGG - Intergenic
978468914 4:109039973-109039995 TTGTTACTTGCTAATATCTTTGG - Intronic
978514855 4:109559483-109559505 AGGTTGCTCTTTAATGCCTTTGG + Intergenic
979474066 4:121134485-121134507 CTGTAACTCATTAATATCTGTGG + Intronic
980486302 4:133461661-133461683 ATGGTCCACTTTAATATCTGAGG + Intergenic
980802588 4:137770956-137770978 ATATTTCTTTTTCATATCTTTGG + Intergenic
981284406 4:142998521-142998543 ATGTTAATATAAAATATCTTGGG + Intergenic
981634509 4:146861268-146861290 ATTTTTCTCTTTCAAATCTTAGG + Intronic
981910176 4:149969967-149969989 ATGTTACTCTTTATTCCATTAGG - Intergenic
981931451 4:150193381-150193403 ATGTTATTCTTTATTTTCATTGG - Intronic
982468012 4:155755201-155755223 ATGTGCCTCTTTAATCTCTGTGG - Intergenic
983668143 4:170205564-170205586 ATTTAAGTCTTTAATTTCTTTGG - Intergenic
984609346 4:181820012-181820034 ATGCAACTCTTTAATAAATTAGG + Intergenic
986891002 5:12305533-12305555 TTGTTACTTTTTAATCTTTTTGG - Intergenic
987756970 5:22109107-22109129 ATTTTACTCTTTATGATATTTGG + Intronic
987776866 5:22378086-22378108 ATTTTACATGTTAATATCTTTGG + Intronic
987890981 5:23878156-23878178 TTATTAATCTTTAATTTCTTTGG - Intergenic
988333403 5:29873339-29873361 ATGATACTCTTTATCTTCTTTGG - Intergenic
988397808 5:30717515-30717537 ATTTTACTCTTTGATATATAGGG + Intergenic
988736732 5:34029878-34029900 ATGTTACTTTTAAATATGATGGG - Intronic
990291702 5:54358661-54358683 ATGATAATGTTTGATATCTTGGG + Intergenic
990669132 5:58107607-58107629 AGGTTACTCTTTACTACCTTTGG - Intergenic
991060964 5:62375628-62375650 CTGTTACTCTAGAATATTTTGGG - Intronic
991518029 5:67461099-67461121 ATTTTACTTTTTAATATTTGGGG + Intergenic
992170458 5:74096627-74096649 ATGTCACTCTATAATAAGTTGGG + Intergenic
993770879 5:91924941-91924963 ATTTTACTTCTTAATATCTATGG - Intergenic
993838911 5:92851711-92851733 ATCTTACTTTTGAAAATCTTGGG + Intergenic
994001528 5:94787207-94787229 ATGTTTCTTTTAAATATCTATGG + Intronic
994341239 5:98631047-98631069 TTTTTAATCTTTAATATTTTGGG - Intergenic
995238773 5:109861493-109861515 ATGTTATTTTTAAATATCTGAGG - Intronic
995777629 5:115741660-115741682 ATGATACTATTTAATATCTGTGG + Intergenic
996629318 5:125608329-125608351 ATTTTATTCTTAAATATATTTGG - Intergenic
996870277 5:128183612-128183634 ATTTTACTGTTAAATATCTTTGG + Intronic
997768555 5:136530096-136530118 ATGTAAATCTTTTATATTTTTGG + Intergenic
998772653 5:145564146-145564168 AAGTTTCTCTTTAAAAGCTTTGG - Intronic
998860250 5:146436521-146436543 ATTTTAATTTTTAATAGCTTTGG - Intergenic
999840730 5:155423357-155423379 CTTTTACTTTTAAATATCTTAGG + Intergenic
1000995443 5:167953736-167953758 ATTTTAAACTTTAATAACTTAGG + Intronic
1001726939 5:173911523-173911545 AAGTTATTTTTTAATATCTCAGG + Intronic
1003049739 6:2768399-2768421 GGGTGACTCTTTAAGATCTTTGG - Intronic
1003819519 6:9880527-9880549 ATGTTACACTTTAAGAAATTAGG + Intronic
1003833571 6:10042164-10042186 ATTTTACTTTTGAATAACTTTGG + Intronic
1004977113 6:20980532-20980554 ATGTTTCTCTTAAAAATATTTGG - Intronic
1006206719 6:32350637-32350659 ATCTTCCTGTTTAATATGTTAGG + Intronic
1008295970 6:49777754-49777776 GTTTTACTCTTTAATATTATTGG - Intergenic
1009919043 6:70033845-70033867 ATTTTACTCTTGAATTTTTTTGG + Intronic
1009983421 6:70753064-70753086 ATGTAGCTCATTAATATCTCGGG - Intronic
1010059824 6:71609611-71609633 ATGTTTGTCTTTATTATTTTGGG + Intergenic
1010060585 6:71618003-71618025 ATCATACTCTTTAACATCATGGG - Intergenic
1011270597 6:85575559-85575581 TTGTTTCTCTTTAATATTTGTGG - Intronic
1011328184 6:86173817-86173839 TTATTACTCTTTAATATCTCAGG + Intergenic
1013095396 6:106940131-106940153 ATGTTTCTCTTATATGTCTTTGG - Intergenic
1014607972 6:123501966-123501988 ATGTTAATTTTTCATATCTTTGG - Intronic
1016723756 6:147334747-147334769 ATATTAATTTTTATTATCTTTGG + Intronic
1017212281 6:151870284-151870306 GGGTTACTCTTTCATATTTTGGG + Intronic
1017668141 6:156742089-156742111 ATTTTATTATTAAATATCTTAGG - Intergenic
1017961215 6:159222537-159222559 ATATTACTCTGTAGTCTCTTGGG - Intronic
1018153429 6:160962446-160962468 AAGTTACTCTTTTCTCTCTTTGG - Intergenic
1019069832 6:169335200-169335222 ATGTTACTCTGTTAACTCTTAGG + Intergenic
1021023042 7:15628064-15628086 ATGTCACTCTTTGAAACCTTTGG - Intronic
1022460318 7:30598942-30598964 TTGTTCATCTTTAATTTCTTTGG + Intronic
1024837305 7:53536942-53536964 ATTATACTCTTGAATATGTTAGG - Intergenic
1027550955 7:79594575-79594597 TTGGAACTCTTTAATTTCTTGGG + Intergenic
1027574342 7:79913321-79913343 GTGTTACTGTTTAACATCCTAGG - Intergenic
1027613169 7:80388366-80388388 ATGTCACTCTTGAATTTCTTTGG + Intronic
1028029019 7:85885522-85885544 ATCTTACTCTTTAATATATTTGG + Intergenic
1028481853 7:91314963-91314985 TTATTACTCTTTTTTATCTTTGG + Intergenic
1029440519 7:100584501-100584523 ATGTTATTCTTTACTTCCTTAGG - Intronic
1029502742 7:100943607-100943629 ATGTTACTTTTTAATGTAGTAGG + Intergenic
1030836106 7:114288175-114288197 ATTTTACTCTTTAGTTTTTTTGG + Intronic
1031597200 7:123662073-123662095 ATTTGACTTTTAAATATCTTTGG - Exonic
1033128596 7:138726287-138726309 GTGTTTCTATTTAAAATCTTCGG - Intronic
1035531935 8:359702-359724 ATGTTACTCTTTATAGTTTTGGG + Intergenic
1035912051 8:3578184-3578206 ATGTTACGCTTTAAAAAATTAGG + Intronic
1036858609 8:12323865-12323887 ATGTTTCTCTTTAGTTCCTTAGG - Intergenic
1038979739 8:32746396-32746418 ATTTTTCTCTTTAACATCTTGGG - Intronic
1039719492 8:40147284-40147306 TTGTTTCTCTTTTATGTCTTTGG + Intergenic
1040654777 8:49494399-49494421 ATGTTAATTTTCAATAGCTTTGG - Intergenic
1040822006 8:51571025-51571047 CTATTACTGTTTAAGATCTTTGG - Intronic
1040952800 8:52953505-52953527 AGGTTACAGTTAAATATCTTGGG - Intergenic
1041220086 8:55642091-55642113 ATGTTATTTTTTAATTTTTTGGG + Intergenic
1042494382 8:69439970-69439992 ATTTTACTCTCTTATATTTTGGG - Intergenic
1042884346 8:73531307-73531329 ATGTTCCTTTGTGATATCTTTGG - Intronic
1043320586 8:78980759-78980781 ATGTTACTCTTGAAAACTTTAGG - Intergenic
1043711606 8:83425733-83425755 AAGTGTCTCTTTAATTTCTTAGG + Intergenic
1044105309 8:88197796-88197818 ATGTTACTCTATGACATTTTGGG + Intronic
1044141995 8:88667687-88667709 ATGTTAAATTTTAATATCTAGGG + Intergenic
1044147283 8:88732834-88732856 CTGATACTCATTAATATCCTGGG + Intergenic
1044498896 8:92928127-92928149 ATATTATTCTGTATTATCTTTGG - Intronic
1044949763 8:97424320-97424342 AAGTTTCTCTTTAAAAGCTTTGG + Intergenic
1045563548 8:103290087-103290109 ATGTTACTATTTAATTATTTGGG - Intergenic
1045567214 8:103332291-103332313 ATGTTAGTCTTTTGTATATTAGG + Exonic
1045912980 8:107432199-107432221 ATTTTAGTCTATAATGTCTTTGG - Intronic
1047770876 8:128028840-128028862 ATGTTATTTTTTATTATTTTGGG + Intergenic
1048631780 8:136250895-136250917 ATGTTACTCTTTTTTAAATTGGG - Intergenic
1049727077 8:144152227-144152249 ATTTTTCTATTTAATATTTTTGG + Intronic
1050289300 9:4137481-4137503 ATGATACATTTTAATCTCTTGGG - Intronic
1051857493 9:21585708-21585730 ATTTTACTCTTAAATGTTTTTGG - Intergenic
1054732082 9:68711550-68711572 ATATCACTCTTCAAAATCTTGGG + Intronic
1055648837 9:78387360-78387382 ATGATACTCTTGAACATTTTTGG + Intergenic
1055733007 9:79298354-79298376 ATATTACTATTTGATATCTCAGG + Intergenic
1056383763 9:86078821-86078843 ATACTACTCTTCGATATCTTGGG + Intronic
1056769855 9:89469122-89469144 ATGTTCCTTTTTAATGTCTATGG - Intronic
1057060133 9:91996599-91996621 ATGTTAATCATTATTATCGTGGG + Intergenic
1058605778 9:106721290-106721312 ATATTACTTCTTCATATCTTTGG + Intergenic
1058932678 9:109736979-109737001 ATGCTAATCTTTAACATCATTGG + Intronic
1061600115 9:131663385-131663407 ATGTCAGTGTTAAATATCTTGGG - Intronic
1186544171 X:10431787-10431809 TTATTACTTTTTAATATCTCTGG - Intergenic
1186571917 X:10724023-10724045 ATCTTACTCTGTAAGATATTAGG + Intronic
1186999412 X:15159812-15159834 CTGTTATTCCTTAATTTCTTGGG - Intergenic
1187632905 X:21194790-21194812 ATTTTACACTTTACTATCTTAGG - Intergenic
1189405924 X:40722746-40722768 ATGGTGCTCTCTAATATGTTTGG + Intronic
1191245098 X:58222296-58222318 TTGTTACTCGTTATTATCATGGG - Intergenic
1191594380 X:62925931-62925953 AGGTTACTCTTTAGTATTTTTGG - Intergenic
1191597171 X:62958529-62958551 ATTTTTCTTTTTAAAATCTTTGG - Intergenic
1191806838 X:65145090-65145112 ATGTTGCTGTCTAATTTCTTAGG + Intergenic
1192850542 X:74951400-74951422 ATGGTATTCTTTAATAAATTGGG + Intergenic
1193213825 X:78839507-78839529 AACTTACTTTTAAATATCTTTGG - Intergenic
1194059992 X:89183966-89183988 TTGTTGCTCTATAAAATCTTTGG + Intergenic
1194609870 X:96029891-96029913 ATGCTACTCTTTATTTTATTAGG - Intergenic
1194693850 X:97020833-97020855 ATTTTTCCATTTAATATCTTTGG + Intronic
1195582736 X:106526944-106526966 ATGTTACTGTTTAGTGTCCTTGG + Intergenic
1195719486 X:107852744-107852766 CTGTAGCTCCTTAATATCTTTGG - Intronic
1195796949 X:108660763-108660785 TTGTTATTTTTTAATAACTTTGG + Intronic
1195978574 X:110554295-110554317 ATGTTAAATATTAATATCTTAGG - Intergenic
1196892401 X:120304092-120304114 ATCTCACTCTTTAATACCTCAGG - Intronic
1197292936 X:124682272-124682294 ATGATACCTTTTAAAATCTTAGG - Intronic
1201332719 Y:12844264-12844286 ATATTACACTTTTATATCTGTGG + Intronic
1202018497 Y:20436876-20436898 ATTTTAGTCTTTAGTATATTTGG - Intergenic