ID: 1122474663

View in Genome Browser
Species Human (GRCh38)
Location 14:101998696-101998718
Sequence TGTGCTTAATTTTGATTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 317}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122474654_1122474663 21 Left 1122474654 14:101998652-101998674 CCTGTAACCGTTTCCGTGCTGCT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1122474663 14:101998696-101998718 TGTGCTTAATTTTGATTTGATGG 0: 1
1: 0
2: 3
3: 20
4: 317
1122474662_1122474663 -7 Left 1122474662 14:101998680-101998702 CCTGCAGGTTCTACTGTGTGCTT 0: 1
1: 0
2: 1
3: 19
4: 197
Right 1122474663 14:101998696-101998718 TGTGCTTAATTTTGATTTGATGG 0: 1
1: 0
2: 3
3: 20
4: 317
1122474653_1122474663 25 Left 1122474653 14:101998648-101998670 CCTGCCTGTAACCGTTTCCGTGC 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1122474663 14:101998696-101998718 TGTGCTTAATTTTGATTTGATGG 0: 1
1: 0
2: 3
3: 20
4: 317
1122474658_1122474663 8 Left 1122474658 14:101998665-101998687 CCGTGCTGCTGGGCCCCTGCAGG 0: 1
1: 0
2: 5
3: 62
4: 493
Right 1122474663 14:101998696-101998718 TGTGCTTAATTTTGATTTGATGG 0: 1
1: 0
2: 3
3: 20
4: 317
1122474657_1122474663 14 Left 1122474657 14:101998659-101998681 CCGTTTCCGTGCTGCTGGGCCCC 0: 1
1: 0
2: 1
3: 20
4: 182
Right 1122474663 14:101998696-101998718 TGTGCTTAATTTTGATTTGATGG 0: 1
1: 0
2: 3
3: 20
4: 317
1122474652_1122474663 29 Left 1122474652 14:101998644-101998666 CCATCCTGCCTGTAACCGTTTCC 0: 1
1: 0
2: 2
3: 8
4: 135
Right 1122474663 14:101998696-101998718 TGTGCTTAATTTTGATTTGATGG 0: 1
1: 0
2: 3
3: 20
4: 317
1122474661_1122474663 -6 Left 1122474661 14:101998679-101998701 CCCTGCAGGTTCTACTGTGTGCT 0: 1
1: 0
2: 0
3: 20
4: 186
Right 1122474663 14:101998696-101998718 TGTGCTTAATTTTGATTTGATGG 0: 1
1: 0
2: 3
3: 20
4: 317
1122474651_1122474663 30 Left 1122474651 14:101998643-101998665 CCCATCCTGCCTGTAACCGTTTC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1122474663 14:101998696-101998718 TGTGCTTAATTTTGATTTGATGG 0: 1
1: 0
2: 3
3: 20
4: 317
1122474660_1122474663 -5 Left 1122474660 14:101998678-101998700 CCCCTGCAGGTTCTACTGTGTGC 0: 1
1: 0
2: 0
3: 10
4: 174
Right 1122474663 14:101998696-101998718 TGTGCTTAATTTTGATTTGATGG 0: 1
1: 0
2: 3
3: 20
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122474663 Original CRISPR TGTGCTTAATTTTGATTTGA TGG Intronic