ID: 1122479737

View in Genome Browser
Species Human (GRCh38)
Location 14:102039288-102039310
Sequence CGGCCAAGGAGCTACTGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122479737_1122479745 14 Left 1122479737 14:102039288-102039310 CCCGCACAGTAGCTCCTTGGCCG 0: 1
1: 1
2: 0
3: 5
4: 60
Right 1122479745 14:102039325-102039347 GGCCCTGCACAGTAGCTCCTTGG 0: 1
1: 1
2: 2
3: 21
4: 182
1122479737_1122479743 -7 Left 1122479737 14:102039288-102039310 CCCGCACAGTAGCTCCTTGGCCG 0: 1
1: 1
2: 0
3: 5
4: 60
Right 1122479743 14:102039304-102039326 TTGGCCGCACAGAGGCTGGCGGG 0: 1
1: 0
2: 1
3: 10
4: 179
1122479737_1122479742 -8 Left 1122479737 14:102039288-102039310 CCCGCACAGTAGCTCCTTGGCCG 0: 1
1: 1
2: 0
3: 5
4: 60
Right 1122479742 14:102039303-102039325 CTTGGCCGCACAGAGGCTGGCGG 0: 1
1: 0
2: 0
3: 41
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122479737 Original CRISPR CGGCCAAGGAGCTACTGTGC GGG (reversed) Intronic
907051185 1:51330645-51330667 CGGCCATGGCCCTACGGTGCGGG - Intronic
1074839694 10:117337766-117337788 GGGCAAGGGAGCTACTTTGCTGG - Intronic
1077155302 11:1088422-1088444 CGGCCCAGGAGCGGCGGTGCGGG - Intergenic
1077283422 11:1755554-1755576 CAGCCAAGGTGCTCCTGGGCAGG + Intronic
1084171199 11:67401798-67401820 CGGGCCAGGAGCTGCTGGGCTGG - Intronic
1086655365 11:89347824-89347846 TTGCCAAGTAGCTAGTGTGCTGG + Intronic
1096069079 12:48764743-48764765 CGGCCAAGCAGTTGCTGGGCTGG + Intergenic
1115712937 14:36070568-36070590 TCTCCAAGGAGCTCCTGTGCCGG + Intergenic
1122130804 14:99603882-99603904 CGGACGAGGAGCTGCTGCGCTGG - Exonic
1122479737 14:102039288-102039310 CGGCCAAGGAGCTACTGTGCGGG - Intronic
1122479747 14:102039328-102039350 TGGCCAAGGAGCTACTGTGCAGG - Intronic
1128733094 15:70034108-70034130 AGGCCAGGGTGCTACTGTTCTGG + Intergenic
1134093852 16:11405921-11405943 TGGCCAAGGAGCCACTGGGCTGG - Intronic
1143520041 17:7439760-7439782 TGTCCAAGGTGCGACTGTGCGGG + Exonic
1153822937 18:8847800-8847822 CAGACAAGGGGCCACTGTGCAGG - Intergenic
1163583316 19:18151018-18151040 CGGCCAAGGGCTTACTCTGCTGG - Exonic
1164402384 19:27911010-27911032 CTGCCTAGGAGCCACTGGGCAGG + Intergenic
1166205025 19:41264209-41264231 AGGCCTAGGAGCTACTGGGGAGG - Intronic
925874503 2:8300489-8300511 AGGCCAAGGAGCCAACGTGCAGG + Intergenic
925889357 2:8421180-8421202 GGGCCAAGGTGCTGCTATGCAGG - Intergenic
926221962 2:10942300-10942322 CTGCCAAGGCGCTAATGTGGGGG - Intergenic
928632534 2:33208645-33208667 CAGCCAAGGAGCTACGTGGCAGG - Intronic
936013316 2:108939735-108939757 CTGCCAATGGGCTACTGTGCTGG + Intronic
941077224 2:161019718-161019740 CAGCCAAGGTGCTGCTGAGCTGG + Intergenic
943007906 2:182409007-182409029 AGCCCAAGGAGCTACTGTGGAGG - Intronic
947667711 2:231917780-231917802 CAACCAAGGCGCTCCTGTGCTGG + Intergenic
948195127 2:236089988-236090010 CAGCCAGGGAGCTGCTGTACAGG - Intronic
948729918 2:239956347-239956369 GGGACAAGCAGCTGCTGTGCTGG - Intronic
1175399858 20:58693838-58693860 CGGCCGAGGGGCTGTTGTGCCGG - Exonic
1178662636 21:34520371-34520393 CGGGCCAGGAGCTGCTGTGGGGG + Intronic
1180967819 22:19799694-19799716 CAGCCAAGGAGTCACAGTGCAGG + Intronic
953782751 3:45886060-45886082 CTGCCTAGTAGCTACTGTGTTGG + Intronic
955598105 3:60613732-60613754 AGGCCAAGGAGCTAGTGAGCAGG - Intronic
956746757 3:72316736-72316758 AGGCCAAGGAGCTACTGCCGGGG - Intergenic
958659136 3:97042905-97042927 CTGGCAGGGAGCTACAGTGCTGG - Intronic
961601956 3:128069302-128069324 AGGCCAAGGCGCTGCTGTCCAGG - Intronic
965118683 3:164522395-164522417 GGGCCAAGGTGGTACAGTGCTGG + Intergenic
965283390 3:166783414-166783436 AGGACAAGCATCTACTGTGCTGG + Intergenic
969423377 4:7109844-7109866 CGGCCATGGGGCTCCTGTCCTGG + Intergenic
981746839 4:148060533-148060555 TATCCAAGCAGCTACTGTGCTGG + Intronic
989552992 5:42757329-42757351 CGGCGAAGGACCAACTGTGTGGG + Intronic
994724588 5:103419324-103419346 CTGCCAAGGAGCTGCAGTTCTGG + Intergenic
998517661 5:142770553-142770575 CGGCCGAGGTGCTGCTGTTCCGG - Exonic
998812185 5:145977460-145977482 CAGCCAAGGAGATACTCTGTAGG + Intronic
1001820097 5:174703659-174703681 CAGCCAAGGAAGAACTGTGCAGG + Intergenic
1002067426 5:176658949-176658971 GGGCCAAGGAGCCACATTGCTGG - Exonic
1006119454 6:31795320-31795342 CGGCGAAGGAGCTCCCGTGAGGG - Intronic
1008078587 6:47171196-47171218 TGACCAAGGACCTCCTGTGCAGG + Intergenic
1018711727 6:166502059-166502081 GGGCTGGGGAGCTACTGTGCAGG + Intronic
1021731245 7:23597553-23597575 CCGCCACGGAGCTTCTGAGCCGG - Exonic
1026681720 7:72472091-72472113 CAGCCAAGGAGGTCCTGTGAAGG + Intergenic
1027266953 7:76499706-76499728 CGGACAAGAAGCTCCTGAGCTGG - Intronic
1027318768 7:76999574-76999596 CGGACAAGAAGCTCCTGAGCTGG - Intergenic
1028332096 7:89607471-89607493 CAGCCAAGGAGTCACTGAGCGGG - Intergenic
1032079782 7:128853094-128853116 CGGCCAAGGGGGTGCTGGGCAGG - Intronic
1038412437 8:27368751-27368773 TGGCCATGGAGCTTCTGTCCAGG + Intronic
1038432688 8:27512710-27512732 AGGCCAGACAGCTACTGTGCAGG + Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1040342580 8:46448396-46448418 CGGCCCAGGAGCTTCTGGGAAGG + Intergenic
1048774063 8:137925892-137925914 TGGACAAGGAGCTAGTGGGCAGG + Intergenic
1049551156 8:143260594-143260616 CGGCCCAGGAGGTGCTGTCCAGG - Intronic
1055326836 9:75139310-75139332 AGGCGGATGAGCTACTGTGCTGG + Intronic
1057143258 9:92740507-92740529 CGGCCAAAGCAGTACTGTGCTGG + Intronic
1058717023 9:107731616-107731638 CGGCCAGAGAGCTGCTGAGCTGG - Intergenic
1186950201 X:14616006-14616028 CCCCCAAGAAGCTATTGTGCTGG + Intronic
1188444045 X:30238224-30238246 AGGCCCAGAAGCCACTGTGCTGG + Intergenic
1200094502 X:153650804-153650826 TGGCCTAGGAGCTACTGGGCAGG + Exonic