ID: 1122479747

View in Genome Browser
Species Human (GRCh38)
Location 14:102039328-102039350
Sequence TGGCCAAGGAGCTACTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122479747_1122479754 4 Left 1122479747 14:102039328-102039350 CCTGCACAGTAGCTCCTTGGCCA 0: 1
1: 1
2: 2
3: 9
4: 137
Right 1122479754 14:102039355-102039377 GAAGTTCAGCGGGGTGCCGAGGG 0: 1
1: 0
2: 1
3: 6
4: 53
1122479747_1122479749 -7 Left 1122479747 14:102039328-102039350 CCTGCACAGTAGCTCCTTGGCCA 0: 1
1: 1
2: 2
3: 9
4: 137
Right 1122479749 14:102039344-102039366 TTGGCCACGCAGAAGTTCAGCGG 0: 1
1: 0
2: 2
3: 193
4: 5976
1122479747_1122479750 -6 Left 1122479747 14:102039328-102039350 CCTGCACAGTAGCTCCTTGGCCA 0: 1
1: 1
2: 2
3: 9
4: 137
Right 1122479750 14:102039345-102039367 TGGCCACGCAGAAGTTCAGCGGG 0: 1
1: 0
2: 1
3: 10
4: 127
1122479747_1122479753 3 Left 1122479747 14:102039328-102039350 CCTGCACAGTAGCTCCTTGGCCA 0: 1
1: 1
2: 2
3: 9
4: 137
Right 1122479753 14:102039354-102039376 AGAAGTTCAGCGGGGTGCCGAGG 0: 1
1: 0
2: 2
3: 24
4: 297
1122479747_1122479751 -5 Left 1122479747 14:102039328-102039350 CCTGCACAGTAGCTCCTTGGCCA 0: 1
1: 1
2: 2
3: 9
4: 137
Right 1122479751 14:102039346-102039368 GGCCACGCAGAAGTTCAGCGGGG 0: 1
1: 0
2: 0
3: 11
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122479747 Original CRISPR TGGCCAAGGAGCTACTGTGC AGG (reversed) Intronic
900068544 1:751365-751387 TGGCCAGGGAGTTGCTGGGCTGG - Intergenic
903583143 1:24387399-24387421 TGCCCAAGGAGCTCCTAGGCAGG + Intronic
904746667 1:32715702-32715724 TGGTCCAGGAGCTCCTGGGCTGG - Intergenic
905633388 1:39531614-39531636 TGGAGAAGGAGCACCTGTGCTGG + Intergenic
910820338 1:91338493-91338515 TGGCTAAGGAGCTATGGTGGTGG - Intronic
912908795 1:113735633-113735655 TGGCTAAGTAGCTACTATACTGG + Intronic
916576561 1:166072247-166072269 TGGCCTAGGAGGTACTGTAGGGG - Intronic
920019966 1:202948278-202948300 TGGCCTATGAGCTTCTGTCCTGG - Intronic
922366611 1:224871224-224871246 TTGCCAAGGAGCTAGTCTGATGG + Intergenic
922867192 1:228870132-228870154 TGGTCCTGGAGCTACTGTGTGGG + Intergenic
1065070900 10:22022753-22022775 TGGCCAAGGTGGAACTGTGGAGG - Intergenic
1065187598 10:23183870-23183892 TGGCCAATGAACTACTTTTCTGG + Intergenic
1066660900 10:37737515-37737537 TGGGCCAGAAGCTGCTGTGCTGG + Intergenic
1067358504 10:45554584-45554606 TGACCCAGGAGCTAATGTGAAGG + Intronic
1069806003 10:71125471-71125493 TGGGGAAGGAGCTTGTGTGCTGG + Intergenic
1072308402 10:94130625-94130647 TGGCCATGGAGATGGTGTGCTGG - Intronic
1074839694 10:117337766-117337788 GGGCAAGGGAGCTACTTTGCTGG - Intronic
1077535706 11:3122977-3122999 TGGCCAAGGAGCAGCCATGCTGG - Intronic
1078439947 11:11356337-11356359 TGGCCAAGAAGCTACCTTCCAGG + Intronic
1084240688 11:67817836-67817858 TGGGCCAGCAGCTGCTGTGCTGG - Intergenic
1086655365 11:89347824-89347846 TTGCCAAGTAGCTAGTGTGCTGG + Intronic
1088342496 11:108784503-108784525 TGGGCAAAGAGCTACTCTGGAGG - Intronic
1091677549 12:2502168-2502190 TGACCAGGCAGCTACAGTGCAGG - Intronic
1091970228 12:4780500-4780522 TGGCCACGGATCTGCTGTGTTGG - Intronic
1095350177 12:41200957-41200979 TTCTCAAGAAGCTACTGTGCAGG - Intronic
1096531086 12:52243280-52243302 TGGCCAAGAACATTCTGTGCTGG - Intronic
1098527596 12:71503977-71503999 TGTGCCAGGAACTACTGTGCAGG + Intronic
1098569510 12:71972993-71973015 TGATCCAGGAGCTGCTGTGCTGG + Intronic
1101448402 12:104754934-104754956 TGACTAAGGAGCTACTCTGTAGG - Intronic
1101796616 12:107980879-107980901 TGGCCAAGGAGATTTTCTGCAGG + Intergenic
1102027835 12:109723588-109723610 TGGCCAAGTCCCTACTGGGCAGG + Intronic
1103339438 12:120213676-120213698 TGGCCCAGGACCTACTGGACTGG + Intronic
1109641522 13:65198207-65198229 TGGCCAAGGAACTACTAGTCTGG - Intergenic
1112441268 13:99426542-99426564 TGGCCAAGGGGATACTGAGGTGG - Intergenic
1112928633 13:104707964-104707986 TGGCCAATGAGCTGCTGGGAAGG + Intergenic
1115712937 14:36070568-36070590 TCTCCAAGGAGCTCCTGTGCCGG + Intergenic
1116426528 14:44798733-44798755 TGGGCCAGCAGCTGCTGTGCTGG + Intergenic
1117194325 14:53324411-53324433 TGGCCAAGGAGAGGCCGTGCAGG - Intergenic
1118812760 14:69287324-69287346 TGGCTAGGCAGCCACTGTGCTGG - Intronic
1122097147 14:99380607-99380629 TTGCCGAGAAGCTGCTGTGCTGG - Intergenic
1122479737 14:102039288-102039310 CGGCCAAGGAGCTACTGTGCGGG - Intronic
1122479747 14:102039328-102039350 TGGCCAAGGAGCTACTGTGCAGG - Intronic
1122809805 14:104282297-104282319 TTGCCAAGGAGCTCAGGTGCTGG + Intergenic
1123806345 15:23877742-23877764 TGACCAAGGAGGGACTGGGCAGG + Intergenic
1127122314 15:55782166-55782188 TGGCCAGGGCTCTACTGAGCTGG + Intergenic
1128733094 15:70034108-70034130 AGGCCAGGGTGCTACTGTTCTGG + Intergenic
1129172662 15:73817553-73817575 TGGCCTTGGAGCTATTTTGCTGG - Intergenic
1129304983 15:74653500-74653522 TTGCCAAGCAGCGTCTGTGCTGG - Intronic
1129381557 15:75170915-75170937 TGGCTGATGTGCTACTGTGCTGG + Intergenic
1131095635 15:89652832-89652854 TGCCCAAGGAGCTGCTGCACGGG - Exonic
1131223910 15:90608119-90608141 TGGCCAGGGGGCAACTGAGCAGG - Intronic
1134093852 16:11405921-11405943 TGGCCAAGGAGCCACTGGGCTGG - Intronic
1137675423 16:50301614-50301636 TGGCCTGGGAGCCACTGGGCAGG + Intronic
1140482377 16:75268410-75268432 TGGCAAAGGAGCTCCTGCCCTGG + Intergenic
1142423933 16:89990730-89990752 TGGCTAAGGAGCTGCAGGGCAGG - Intergenic
1143335080 17:6166023-6166045 TGCCCCAGGAGCCAGTGTGCAGG - Intergenic
1143520041 17:7439760-7439782 TGTCCAAGGTGCGACTGTGCGGG + Exonic
1148023379 17:44568357-44568379 TGGGCCAGTAGCTGCTGTGCTGG + Intergenic
1152049014 17:77958495-77958517 TGGCCGAGGAGCCAATGGGCCGG + Intergenic
1157813094 18:50711596-50711618 TGGCCAAGGAGGGAGTGAGCAGG - Intronic
1160040739 18:75343447-75343469 TGGCCCAGTGGCCACTGTGCGGG + Intergenic
1160933364 19:1581195-1581217 TGGGCATGGTGCTAGTGTGCAGG + Exonic
1164868867 19:31626826-31626848 TGCCTAAGGACCTACTGTGGTGG - Intergenic
1165751825 19:38264888-38264910 TGGCCATGGCGCAGCTGTGCGGG + Exonic
1166205025 19:41264209-41264231 AGGCCTAGGAGCTACTGGGGAGG - Intronic
1168341333 19:55624623-55624645 TGGCGTAAGAGCTACTGCGCAGG + Intergenic
925874503 2:8300489-8300511 AGGCCAAGGAGCCAACGTGCAGG + Intergenic
925889357 2:8421180-8421202 GGGCCAAGGTGCTGCTATGCAGG - Intergenic
929957565 2:46470372-46470394 TGGCCTAGCAGGGACTGTGCTGG - Intronic
930241460 2:48939791-48939813 TGGCCAAGTGGCTACTGTATAGG + Intergenic
936013316 2:108939735-108939757 CTGCCAATGGGCTACTGTGCTGG + Intronic
942612749 2:177758726-177758748 TGGCCAAGGAGGCACCGTGGAGG - Intronic
943007906 2:182409007-182409029 AGCCCAAGGAGCTACTGTGGAGG - Intronic
945451484 2:210000793-210000815 TGGGCCAGCAGCTGCTGTGCTGG - Intergenic
946037319 2:216754529-216754551 TGGGGAAGGAGCTGCTTTGCTGG - Intergenic
948221362 2:236272256-236272278 TGGCCAAGGAGCTTCACCGCTGG - Intergenic
948729918 2:239956347-239956369 GGGACAAGCAGCTGCTGTGCTGG - Intronic
1169341395 20:4799209-4799231 TGGCTAAGGAGGTCCAGTGCTGG - Intronic
1171962922 20:31508013-31508035 TAGCCATGGAGCTGCTGTACTGG + Intergenic
1173579962 20:44140270-44140292 TGGTCAGGGAGAAACTGTGCAGG + Intronic
1175542273 20:59755279-59755301 TGGCCAAGGGGCTTCCGGGCTGG - Exonic
1175738500 20:61404094-61404116 TGGGCAAGGAGACACTGGGCAGG + Intronic
1178391923 21:32205888-32205910 TGGCCAAGCTGCTTCTGGGCTGG + Intergenic
1178820028 21:35966607-35966629 TGCCCAAGGCTCTACTGTCCAGG - Intronic
1181898339 22:26130848-26130870 TGGCCAAGGAGCACCTGAACAGG - Intergenic
1181980523 22:26762798-26762820 TGGCCCAGGCTCTGCTGTGCAGG - Intergenic
1184447283 22:44556238-44556260 TGGCCAAGAAGATAATTTGCAGG - Intergenic
1184805589 22:46793134-46793156 TGGGCCAGGAGCGCCTGTGCAGG - Intronic
950136349 3:10583938-10583960 TTGCCAAGGAGCTGCTGTCAGGG - Intronic
954218051 3:49135313-49135335 TGGCCTGGTAGCCACTGTGCAGG - Intergenic
954276306 3:49543975-49543997 TGGCAAAGGAGCAAGTATGCAGG - Intergenic
955598105 3:60613732-60613754 AGGCCAAGGAGCTAGTGAGCAGG - Intronic
956746757 3:72316736-72316758 AGGCCAAGGAGCTACTGCCGGGG - Intergenic
961050384 3:123740633-123740655 TGGGCAAGGTGCTGCTATGCTGG + Intronic
961050390 3:123740669-123740691 TGGGCAAGGCGCTGCTATGCTGG + Intronic
961050401 3:123740741-123740763 TGGGCAAGGCGCTGCTATGCTGG + Intronic
961601956 3:128069302-128069324 AGGCCAAGGCGCTGCTGTCCAGG - Intronic
965118683 3:164522395-164522417 GGGCCAAGGTGGTACAGTGCTGG + Intergenic
965283390 3:166783414-166783436 AGGACAAGCATCTACTGTGCTGG + Intergenic
965284822 3:166805414-166805436 TGGCAAAGGAGCTATGGTGGTGG - Intergenic
969417690 4:7071670-7071692 TAGCCTAGGTGCTGCTGTGCAGG + Intergenic
971331734 4:25686990-25687012 TGCCCAGGTAGCTGCTGTGCTGG - Intergenic
981746839 4:148060533-148060555 TATCCAAGCAGCTACTGTGCTGG + Intronic
982692779 4:158567082-158567104 TGGGCCAGCAGCTGCTGTGCTGG + Intronic
991243945 5:64489350-64489372 TGACCAAGGAGCTATGATGCAGG - Intergenic
992266580 5:75024505-75024527 TGGCCAGGGAGCTTCTCAGCGGG + Intergenic
992323752 5:75639781-75639803 TAGCCAAGTAGCTATTGTGTGGG + Intronic
997435461 5:133870916-133870938 TGGCCAAGGAGACACTGCTCAGG + Intergenic
998321230 5:141234538-141234560 TGGCTAAGGAGCTATGGAGCCGG + Intergenic
999233532 5:150077117-150077139 TGGCTAAGGAGCCACTCTCCAGG - Intronic
999348551 5:150845605-150845627 TGGGCCAGCAGCTGCTGTGCTGG + Intergenic
1000294760 5:159903588-159903610 TGGCCAAGTAGCTACTTTAAAGG + Intergenic
1002067426 5:176658949-176658971 GGGCCAAGGAGCCACATTGCTGG - Exonic
1003116316 6:3285987-3286009 TGGCCACGGAGATGCTGTGGTGG + Intronic
1003387341 6:5681249-5681271 TGGACAAGGAACTATTTTGCAGG + Intronic
1005683253 6:28227395-28227417 TGCCCAAGGAGCTCCAGGGCTGG + Exonic
1006452876 6:34115190-34115212 TGGGCCAGGAGCTGCTGTTCTGG - Intronic
1008078587 6:47171196-47171218 TGACCAAGGACCTCCTGTGCAGG + Intergenic
1009510796 6:64547899-64547921 TGGGCCAGCAGCTGCTGTGCTGG - Intronic
1010277943 6:73990845-73990867 TGGGCCAGCAGCTGCTGTGCTGG - Intergenic
1012733532 6:102910861-102910883 TGGGCCAGCAGCTGCTGTGCTGG - Intergenic
1015437061 6:133201877-133201899 TGGGCAAGCATCTTCTGTGCAGG - Intergenic
1017404778 6:154107507-154107529 TGGCCACTGAGCTACAATGCAGG + Intronic
1018711727 6:166502059-166502081 GGGCTGGGGAGCTACTGTGCAGG + Intronic
1024199110 7:47088591-47088613 TGGCCATAGAGCCACTGAGCAGG - Intergenic
1024735826 7:52303133-52303155 TGGGCCAGCAGCTGCTGTGCTGG - Intergenic
1029706560 7:102279613-102279635 TGGCCAAGGAGCGGCTCTGATGG - Intronic
1033422806 7:141218210-141218232 TGTGCAAGGATCCACTGTGCTGG - Intronic
1034225114 7:149475555-149475577 TGGCCAGGCAGCTGCTGAGCAGG - Intronic
1036704114 8:11033924-11033946 TGGCCAAGCTGCTTCTCTGCAGG - Intronic
1036831363 8:12022790-12022812 TGGGCCAGCAGCTGCTGTGCTGG + Intergenic
1038224804 8:25645829-25645851 TGGCCACAGAGCCACTGTCCCGG - Intergenic
1038412437 8:27368751-27368773 TGGCCATGGAGCTTCTGTCCAGG + Intronic
1038432688 8:27512710-27512732 AGGCCAGACAGCTACTGTGCAGG + Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1045743335 8:105387505-105387527 TGGGCCAGCAGCTGCTGTGCCGG - Intronic
1048774063 8:137925892-137925914 TGGACAAGGAGCTAGTGGGCAGG + Intergenic
1055307784 9:74948764-74948786 TGACCTAGTGGCTACTGTGCTGG + Intronic
1055326836 9:75139310-75139332 AGGCGGATGAGCTACTGTGCTGG + Intronic
1057717003 9:97502858-97502880 TGGCCAGGGAGCGGCTGTACTGG - Intronic
1057820075 9:98323508-98323530 TGGCCAAGGAGCCTCTCTGTGGG + Intronic
1060744672 9:126123413-126123435 TGGCCAAGGACCTTCTGTCAGGG - Intergenic
1060842063 9:126801538-126801560 TGGCAAAAGAGATTCTGTGCTGG - Intergenic
1061907253 9:133705018-133705040 TGTCCAAGGAGTTCCTGAGCAGG + Exonic
1187896647 X:23988115-23988137 TGGCCATGGTGTGACTGTGCTGG - Exonic
1188162585 X:26821365-26821387 TGGCCAAGGCACTAATGTCCTGG + Intergenic
1188444045 X:30238224-30238246 AGGCCCAGAAGCCACTGTGCTGG + Intergenic
1189267101 X:39725427-39725449 TGCCCCAGGAGCTACAGTACCGG + Intergenic
1199408012 X:147485510-147485532 TGGCAAAGGAGCTATGGTGGTGG + Intergenic
1200094502 X:153650804-153650826 TGGCCTAGGAGCTACTGGGCAGG + Exonic