ID: 1122480227

View in Genome Browser
Species Human (GRCh38)
Location 14:102042453-102042475
Sequence GGAAGCAGGCATGCGGCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 286}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122480227_1122480238 24 Left 1122480227 14:102042453-102042475 CCTGCAGCCGCATGCCTGCTTCC 0: 1
1: 0
2: 1
3: 32
4: 286
Right 1122480238 14:102042500-102042522 ACCCCAAGGTGGGTGGTTGAAGG 0: 1
1: 0
2: 0
3: 24
4: 181
1122480227_1122480235 13 Left 1122480227 14:102042453-102042475 CCTGCAGCCGCATGCCTGCTTCC 0: 1
1: 0
2: 1
3: 32
4: 286
Right 1122480235 14:102042489-102042511 CATGGAGATCAACCCCAAGGTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1122480227_1122480230 -5 Left 1122480227 14:102042453-102042475 CCTGCAGCCGCATGCCTGCTTCC 0: 1
1: 0
2: 1
3: 32
4: 286
Right 1122480230 14:102042471-102042493 CTTCCGACTCTTCCTCACCATGG 0: 1
1: 0
2: 1
3: 14
4: 155
1122480227_1122480233 10 Left 1122480227 14:102042453-102042475 CCTGCAGCCGCATGCCTGCTTCC 0: 1
1: 0
2: 1
3: 32
4: 286
Right 1122480233 14:102042486-102042508 CACCATGGAGATCAACCCCAAGG 0: 1
1: 0
2: 1
3: 9
4: 150
1122480227_1122480242 29 Left 1122480227 14:102042453-102042475 CCTGCAGCCGCATGCCTGCTTCC 0: 1
1: 0
2: 1
3: 32
4: 286
Right 1122480242 14:102042505-102042527 AAGGTGGGTGGTTGAAGGAGTGG 0: 1
1: 0
2: 3
3: 36
4: 544
1122480227_1122480236 14 Left 1122480227 14:102042453-102042475 CCTGCAGCCGCATGCCTGCTTCC 0: 1
1: 0
2: 1
3: 32
4: 286
Right 1122480236 14:102042490-102042512 ATGGAGATCAACCCCAAGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 95
1122480227_1122480237 17 Left 1122480227 14:102042453-102042475 CCTGCAGCCGCATGCCTGCTTCC 0: 1
1: 0
2: 1
3: 32
4: 286
Right 1122480237 14:102042493-102042515 GAGATCAACCCCAAGGTGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122480227 Original CRISPR GGAAGCAGGCATGCGGCTGC AGG (reversed) Exonic