ID: 1122480229

View in Genome Browser
Species Human (GRCh38)
Location 14:102042467-102042489
Sequence GGTGAGGAAGAGTCGGAAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 334}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122480229_1122480235 -1 Left 1122480229 14:102042467-102042489 CCTGCTTCCGACTCTTCCTCACC 0: 1
1: 0
2: 1
3: 24
4: 334
Right 1122480235 14:102042489-102042511 CATGGAGATCAACCCCAAGGTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1122480229_1122480242 15 Left 1122480229 14:102042467-102042489 CCTGCTTCCGACTCTTCCTCACC 0: 1
1: 0
2: 1
3: 24
4: 334
Right 1122480242 14:102042505-102042527 AAGGTGGGTGGTTGAAGGAGTGG 0: 1
1: 0
2: 3
3: 36
4: 544
1122480229_1122480238 10 Left 1122480229 14:102042467-102042489 CCTGCTTCCGACTCTTCCTCACC 0: 1
1: 0
2: 1
3: 24
4: 334
Right 1122480238 14:102042500-102042522 ACCCCAAGGTGGGTGGTTGAAGG 0: 1
1: 0
2: 0
3: 24
4: 181
1122480229_1122480233 -4 Left 1122480229 14:102042467-102042489 CCTGCTTCCGACTCTTCCTCACC 0: 1
1: 0
2: 1
3: 24
4: 334
Right 1122480233 14:102042486-102042508 CACCATGGAGATCAACCCCAAGG 0: 1
1: 0
2: 1
3: 9
4: 150
1122480229_1122480243 27 Left 1122480229 14:102042467-102042489 CCTGCTTCCGACTCTTCCTCACC 0: 1
1: 0
2: 1
3: 24
4: 334
Right 1122480243 14:102042517-102042539 TGAAGGAGTGGAGACGTTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 124
1122480229_1122480236 0 Left 1122480229 14:102042467-102042489 CCTGCTTCCGACTCTTCCTCACC 0: 1
1: 0
2: 1
3: 24
4: 334
Right 1122480236 14:102042490-102042512 ATGGAGATCAACCCCAAGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 95
1122480229_1122480237 3 Left 1122480229 14:102042467-102042489 CCTGCTTCCGACTCTTCCTCACC 0: 1
1: 0
2: 1
3: 24
4: 334
Right 1122480237 14:102042493-102042515 GAGATCAACCCCAAGGTGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122480229 Original CRISPR GGTGAGGAAGAGTCGGAAGC AGG (reversed) Exonic