ID: 1122480230

View in Genome Browser
Species Human (GRCh38)
Location 14:102042471-102042493
Sequence CTTCCGACTCTTCCTCACCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122480226_1122480230 -4 Left 1122480226 14:102042452-102042474 CCCTGCAGCCGCATGCCTGCTTC 0: 1
1: 0
2: 1
3: 16
4: 175
Right 1122480230 14:102042471-102042493 CTTCCGACTCTTCCTCACCATGG 0: 1
1: 0
2: 1
3: 14
4: 155
1122480227_1122480230 -5 Left 1122480227 14:102042453-102042475 CCTGCAGCCGCATGCCTGCTTCC 0: 1
1: 0
2: 1
3: 32
4: 286
Right 1122480230 14:102042471-102042493 CTTCCGACTCTTCCTCACCATGG 0: 1
1: 0
2: 1
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122480230 Original CRISPR CTTCCGACTCTTCCTCACCA TGG Exonic