ID: 1122480231

View in Genome Browser
Species Human (GRCh38)
Location 14:102042474-102042496
Sequence TCTCCATGGTGAGGAAGAGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 286}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122480231_1122480237 -4 Left 1122480231 14:102042474-102042496 CCGACTCTTCCTCACCATGGAGA 0: 1
1: 0
2: 4
3: 23
4: 286
Right 1122480237 14:102042493-102042515 GAGATCAACCCCAAGGTGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 122
1122480231_1122480245 29 Left 1122480231 14:102042474-102042496 CCGACTCTTCCTCACCATGGAGA 0: 1
1: 0
2: 4
3: 23
4: 286
Right 1122480245 14:102042526-102042548 GGAGACGTTGCAGGCTGGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 208
1122480231_1122480244 24 Left 1122480231 14:102042474-102042496 CCGACTCTTCCTCACCATGGAGA 0: 1
1: 0
2: 4
3: 23
4: 286
Right 1122480244 14:102042521-102042543 GGAGTGGAGACGTTGCAGGCTGG 0: 1
1: 0
2: 2
3: 14
4: 171
1122480231_1122480236 -7 Left 1122480231 14:102042474-102042496 CCGACTCTTCCTCACCATGGAGA 0: 1
1: 0
2: 4
3: 23
4: 286
Right 1122480236 14:102042490-102042512 ATGGAGATCAACCCCAAGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 95
1122480231_1122480238 3 Left 1122480231 14:102042474-102042496 CCGACTCTTCCTCACCATGGAGA 0: 1
1: 0
2: 4
3: 23
4: 286
Right 1122480238 14:102042500-102042522 ACCCCAAGGTGGGTGGTTGAAGG 0: 1
1: 0
2: 0
3: 24
4: 181
1122480231_1122480243 20 Left 1122480231 14:102042474-102042496 CCGACTCTTCCTCACCATGGAGA 0: 1
1: 0
2: 4
3: 23
4: 286
Right 1122480243 14:102042517-102042539 TGAAGGAGTGGAGACGTTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 124
1122480231_1122480242 8 Left 1122480231 14:102042474-102042496 CCGACTCTTCCTCACCATGGAGA 0: 1
1: 0
2: 4
3: 23
4: 286
Right 1122480242 14:102042505-102042527 AAGGTGGGTGGTTGAAGGAGTGG 0: 1
1: 0
2: 3
3: 36
4: 544
1122480231_1122480235 -8 Left 1122480231 14:102042474-102042496 CCGACTCTTCCTCACCATGGAGA 0: 1
1: 0
2: 4
3: 23
4: 286
Right 1122480235 14:102042489-102042511 CATGGAGATCAACCCCAAGGTGG 0: 1
1: 0
2: 0
3: 6
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122480231 Original CRISPR TCTCCATGGTGAGGAAGAGT CGG (reversed) Exonic