ID: 1122480233

View in Genome Browser
Species Human (GRCh38)
Location 14:102042486-102042508
Sequence CACCATGGAGATCAACCCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122480228_1122480233 3 Left 1122480228 14:102042460-102042482 CCGCATGCCTGCTTCCGACTCTT 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1122480233 14:102042486-102042508 CACCATGGAGATCAACCCCAAGG 0: 1
1: 0
2: 1
3: 9
4: 150
1122480227_1122480233 10 Left 1122480227 14:102042453-102042475 CCTGCAGCCGCATGCCTGCTTCC 0: 1
1: 0
2: 1
3: 32
4: 286
Right 1122480233 14:102042486-102042508 CACCATGGAGATCAACCCCAAGG 0: 1
1: 0
2: 1
3: 9
4: 150
1122480226_1122480233 11 Left 1122480226 14:102042452-102042474 CCCTGCAGCCGCATGCCTGCTTC 0: 1
1: 0
2: 1
3: 16
4: 175
Right 1122480233 14:102042486-102042508 CACCATGGAGATCAACCCCAAGG 0: 1
1: 0
2: 1
3: 9
4: 150
1122480229_1122480233 -4 Left 1122480229 14:102042467-102042489 CCTGCTTCCGACTCTTCCTCACC 0: 1
1: 0
2: 1
3: 24
4: 334
Right 1122480233 14:102042486-102042508 CACCATGGAGATCAACCCCAAGG 0: 1
1: 0
2: 1
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122480233 Original CRISPR CACCATGGAGATCAACCCCA AGG Exonic